BME103:W930 Group2 l2: Difference between revisions
No edit summary |
|||
Line 88: | Line 88: | ||
'''Primer Design''' | '''Primer Design''' | ||
'''Rs11805303:'''<br> | |||
Sequences: TGCTTGCAAACAGAGAACTGTTTCCT[C]AAACGATCCACTTGCCTTTTATTAG<br> | |||
TGCTTGCAAACAGAGAACTGTTTCCT[T]AAACGATCCACTTGCCTTTTATTAG | |||
'''Rs10210302:'''<br> | |||
Sequences: | |||
AATACTGACTACCAGTGAACCATCTT[C]AACTACAGTGCTAGAAGCCTGACTG<br> | |||
AATACTGACTACCAGTGAACCATCTT[T]AACTACAGTGCTAGAAGCCTGACTG | |||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> |
Revision as of 09:26, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers Crohn's disease is a chronic, autoimmune inflammatory bowel disease (IBD) that causes inflammation of the digestive tract, also known as the gastrointestinal (GI) tract. Chronic, unmanaged inflammation can lead to a variety of symptoms. Researchers have also discovered genetic variations in certain regions of chromosome 5 and chromosome 10 that appear to contribute to Crohn disease risk. One area of chromosome 5, known as the IBD5 locus, contains several genetic changes that may increase the risk of developing this condition. Other regions of chromosome 5 and chromosome 10 identified in studies of Crohn disease risk are known as "gene deserts" because they include no known genes. The SNP's that are associated with this disease are rs11805303, rs10210302, rs9858542 in the BSN gene, rs17234657, rs1000113, rs10761659 and many more.- www.snpedia.com
|