BME103:W930 Group2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Garrett Salcido Open PCR machine engineer Name: Matt Mortensen Open PCR machine engineer Name: Ramesh Tadayon Experimental protocol planner Name: Alanie Harmon Experimental protocol planner Name: Alex Torres R&D Scientist Name: Davey Rand R&D Scientist LAB 1 WRITE-UP Initial Machine Testing The Original Design Experimenting With the Connections When we unplugged part mounting plate from circuit board, the machine had no visible screen and we could not see the the information on the LCD screen. When we unplugged the white wire that connects the circuit board to the sample holder, the machine's temperature was unable to be monitored and could not be regulated Test Run Our group did our test run on October 24, 2012. During the test run, we ran into no problems with the machine. We were done and found our results in a matter of 1 to 2 hours. The Open PCR machine was connected to one computers to control each temperature of each cycle of PCR during the experimental. Protocols Polymerase Chain Reaction How PCR Works: Step 1: Denaturation by Heat: Initially, heat separates a DNA strand into two separate strands. This is allowed because the hydrogen bonds holding the DNA together are weak and easily separable when heated. Step 2: Annealing Primer to Target Sequence: We want to target a sequence specifically and to do that you must use primers. Primers mark the ends of the target sequence. Two primers are included in the PCR one for each of the strands that were just separated during denaturation. The beginning of the DNA target sequence is also marked by the primers that bind (anneal) to the complementary sequence. Step 3: Extension: After the primers bind to the complementary DNA, the temperature is raised and the enzyme Taq DNA polymerase is used to replicate the strands. The Taq DNA polymerase, active at high temperatures, facilitates the binding and joining of the complementary nucleotides. It synthesizes an identical double-stranded DNA strand. Extension begins at the 3’ end of the primer because Taq DNA polymerase synthesizes exclusively in the 5’ to 3’ direction, so the free nucleotides are only added to the 3’ end of the primer. How to Amplify a Patient’s DNA sample 1. A PCR Machine is created to amplify a patient’s DNA sample. In order to use a PCR machine, the steps include to first gather the DNA samples, 50 μL each. 2. The frozen DNA samples are separated into tubes and once melted, 8 transfer pipettes were used to add primer. 3. Once the samples are ready, we processed the DNA in the openPCR system. Components of the PCR master mix 400μM dATP, 400μM dGTP, 400μM dCTP, 400μM dTTP and 3mM MgCl2, reaction buffer (pH 8.5), nuclease-free water Flourimeter Measurements Fluorimeter assembly procedure: Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while still being able to use the smart phone to take pictures. How to open images in Image J- Save the pictures to the phone. Download the pictures onto a computer that has Image J. Open them with Image J by going to add image. Research and Development Specific Cancer Marker Detection - The Underlying Technology Cancer Associated with the gene: Breast and Colorectal cancer with a susceptibility to LiFraumeni Syndrome Chromosome: 22 Gene being analyzed: CHEK2 SNP #: 17879961 SNP's Surrounding DNA: 29,121,087 Cancer-Sequence Primer: TTGAGAATGTGACGTATGTA "Partner Primer": 29,121,080 Description of Gene: "In response to DNA damage and replication blocks, cells prevent cell cycle progression through the control of critical cell cycle regulators. To investigate checkpoint conservation, Matsuoka et al. (1998) used PCR and database analysis to identify CHK2, the mammalian homolog of Saccharomyces cerevisiae Rad53 and Schizosaccharomyces pombe cds1+, protein kinases required for DNA damage and replication checkpoints. The longest human cDNA encoded a 543-amino acid protein with 83% identity to mouse Chk2 and 34% identity to Drosophila Dmnk, a protein highly expressed in ovaries for which a function in meiosis had been suggested. Human CHK2 protein is 26% identical to Rad53 and 26% identical to cds1+. Sequence analysis revealed a single forkhead-associated (FHA) domain, a 60-amino acid protein interaction domain essential for activation in response to DNA damage that is conserved in the Rad53/cds1+ family of kinases. CHK2 has a potential regulatory region rich in SQ and TQ amino acid pairs. Northern blot analysis revealed wide expression of small amounts of CHK2 mRNA with larger amounts in human testis, spleen, colon, and peripheral blood leukocytes. CHK2 complemented the lethality of a Rad53 deletion." Source: http://omim.org/entry/604373?search=CHEK2&highlight=chek2 Normal Gene Sequence: GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC Cancer Gene Sequence: GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC Baye's Rule: p(C|hc) = 7.8% C's found in cancer patients p(hc) = 2.5% p(C) = 5.3% C's in Finland Results Description--------INTDEN Subtracted Background----------DNA Concentration (micrograms/mL) Water Blank----------218527------------------------------- 0 DNA Calf Thymus------6369082----------------------------- 2 Buffer A--------------1193961-------------------------------0 Buffer B --------------5237029 --------------------------- 1.1 Buffer C ----------------5437872---------------------------- 1.2 Buffer D -----------------10726518 --------------------------- 4 Buffer 1-----------------2711977 ---------------------------- 0.7 Buffer 2------------------7637000----------------------------- 2.2 Buffer 3 ----------------1440716------------------------------0.5 Buffer 4-----------------2814775------------------------------ 0.8 Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control E6 F6 G6 PCR: Positive Control E7 F7 G7 PCR: Patient 1 ID #####, rep 1 E8 F8 G8 PCR: Patient 1 ID #####, rep 2 E9 F9 G9 PCR: Patient 1 ID #####, rep 3 E10 F10 G10 PCR: Patient 2 ID #####, rep 1 E11 F11 G11 PCR: Patient 2 ID #####, rep 2 E12 F12 G12 PCR: Patient 2 ID #####, rep 3 E13 F13 G13 KEY Sample = " A set of DNA that is contained with one micro test tube. " Integrated Density = " The sum of the values of the pixels in the images. " DNA μg/mL = " This is the concentration our group obtained in our lab. We measured in micrograms/milimeters. " Conclusion = " The conclusion is the results that our group received in determining if the gene was positive or negative for the cancer gene. "