OUR TEAM
Name: Garrett Salcido Open PCR machine engineer
| Name: Matt Mortensen Open PCR machine engineer
| Name: Ramesh Tadayon Experimental protocol planner
| Name: Alanie Harmon Experimental protocol planner
| Name: Alex Torres R&D Scientist
| Name: Davey Rand R&D Scientist
|
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design

Experimenting With the Connections
When we unplugged part mounting plate from circuit board, Machine #2 had no visible screen and we could not see the the information on the LCD screen.
When we unplugged the white wire that connects the circuit board to the sample holder, the machine's temperature was unable to be monitored and could not be regulated.
Test Run
Our group did our test run on October 24, 2012. During the test run, we ran into no problems with Machine #2. We were done and found our results in a matter of 1 to 2 hours. The Open PCR machine was connected to one computer to control the temperature of each cycle of PCR during the experimental.
Protocols
Polymerase Chain Reaction
How PCR Works:
Step 1: Denaturation by Heat
Initially, heat separates a DNA strand into two separate strands. This is allowed because the hydrogen bonds that hold the DNA together are weak and easily separable when heated.
Step 2: Annealing Primer to Target Sequence
We want to target a sequence specifically and in order to accomplish that you must use primers. Primers mark the end of the target sequence. Two primers are included in the PCR; one for each of the strands that were just separated during denaturation. The beginning of the DNA target sequence is also marked by the primers that bind (anneal) to the complementary sequence.
Step 3: Extension
After the primers bind to the complementary DNA, the temperature is raised and the enzyme Taq DNA polymerase is used to replicate the strands. The Taq DNA polymerase, active at high temperatures, facilitates the binding and joining of the complementary nucleotides. It synthesizes an identical double-stranded DNA strand. Extension begins at the 3’ end of the primer because Taq DNA polymerase synthesizes exclusively in the 5’ to 3’ direction, so the free nucleotides are only added to the 3’ end of the primer.
How to Amplify a Patient’s DNA sample:
1. A PCR Machine is created to amplify a patient’s DNA sample. In order to use a PCR machine, one must first gather the DNA samples, 50 μL each.
2. The frozen DNA samples are placed into separate tubes and once melted, 8 transfer pipettes are used to add primer.
3. Once the samples were ready, we processed the DNA in the openPCR system.
Components of the PCR master mix:
400μM dATP, 400μM dGTP, 400μM dCTP, 400μM dTTP and 3mM MgCl2, reaction buffer (pH 8.5), nuclease-free water
Flourimeter Measurements
Fluorimeter assembly procedure:
Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while maintaining the ability to use the smart phone to take pictures.
How to open images in Image J:
Save the pictures to the phone. Download the pictures onto a computer that has Image J. Open them with Image J by going to add image.
Research and Development

Specific Cancer Marker Detection - The Underlying Technology
Cancer Associated with the gene: Breast and Colorectal cancer with a susceptibility to LiFraumeni Syndrome
Chromosome: 22
Gene being analyzed: CHEK2
SNP #: 17879961
SNP's Surrounding DNA: 29,121,087
Cancer-Sequence Primer: TTGAGAATGTGACGTATGTA
"Partner Primer": 29,121,080
Description of Gene:
"In response to DNA damage and replication blocks, cells prevent cell cycle progression through the control of critical cell cycle regulators. To investigate checkpoint conservation, Matsuoka et al. (1998) used PCR and database analysis to identify CHK2, the mammalian homolog of Saccharomyces cerevisiae Rad53 and Schizosaccharomyces pombe cds1+, protein kinases required for DNA damage and replication checkpoints. The longest human cDNA encoded a 543-amino acid protein with 83% identity to mouse Chk2 and 34% identity to Drosophila Dmnk, a protein highly expressed in ovaries for which a function in meiosis had been suggested. Human CHK2 protein is 26% identical to Rad53 and 26% identical to cds1+. Sequence analysis revealed a single forkhead-associated (FHA) domain, a 60-amino acid protein interaction domain essential for activation in response to DNA damage that is conserved in the Rad53/cds1+ family of kinases. CHK2 has a potential regulatory region rich in SQ and TQ amino acid pairs. Northern blot analysis revealed wide expression of small amounts of CHK2 mRNA with larger amounts in human testis, spleen, colon, and peripheral blood leukocytes. CHK2 complemented the lethality of a Rad53 deletion."
Source: http://omim.org/entry/604373?search=CHEK2&highlight=chek2
Normal Gene Sequence:
GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC
Cancer Gene Sequence:
GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC
Baye's Rule:
p(C|hc) = 7.8% C's found in cancer patients
p(hc) = 2.5%
p(C) = 5.3% C's in Finland
Results
Water

Calf Thymus

| Sample | Integrated Density | DNA μg/mL | Conclusion
|
| PCR: Negative Control | 218527 | 0 | Water
|
| PCR: Positive Control | 6369082 | 2 | Calf Thymus
|
| PCR: Patient 1 ID 43825 Female Age:53, rep 1 | 1193961 | 0 | negative
|
| PCR: Patient 1 ID 43825 Female Age:53, rep 2 | 5237029 | 1.1 | negative
|
| PCR: Patient 1 ID 43825 Female Age:53, rep 3 | 5437872 | 1.2 | negative
|
| PCR: Patient 2 ID 12079 Female Age:56, rep 1 | 10726518 | 4 | positive
|
| PCR: Patient 2 ID 12079 Female Age:56, rep 2 | 2711977 | 0.7 | negative
|
| PCR: Patient 2 ID 12079 Female Age:56, rep 3 | 7637000 | 2.2 | positive
|
KEY
- Sample = " A set of DNA that is contained with one micro test tube. "
- Integrated Density = " The sum of the values of the pixels in the images. "
- DNA μg/mL = " This is the concentration our group obtained in our lab. We measured in micrograms/milimeters. "
- Conclusion = " The conclusion is the results that our group received in determining if the gene was positive or negative for the cancer gene. "
|