BME103:W930 Group2: Difference between revisions
(36 intermediate revisions by 4 users not shown) | |||
Line 16: | Line 16: | ||
| [[Image:Matt-BME103-Group2.jpg|100px|thumb|Name: Matt Mortensen<br>Open PCR machine engineer]] | | [[Image:Matt-BME103-Group2.jpg|100px|thumb|Name: Matt Mortensen<br>Open PCR machine engineer]] | ||
| [[Image:Ramesh-BME103-Group2.jpg|100px|thumb|Name: Ramesh Tadayon<br>Experimental protocol planner]] | | [[Image:Ramesh-BME103-Group2.jpg|100px|thumb|Name: Ramesh Tadayon<br>Experimental protocol planner]] | ||
| [[Image: | | [[Image:Alanie-BME103-Group2.jpg|100px|thumb|Name: Alanie Harmon<br>Experimental protocol planner]] | ||
| [[Image:Alex-BME103-Group2.jpg|100px|thumb|Name: Alex Torres<br>R&D Scientist]] | | [[Image:Alex-BME103-Group2.jpg|100px|thumb|Name: Alex Torres<br>R&D Scientist]] | ||
| [[Image: | | [[Image:Davey-BME103-Group2.jpg|100px|thumb|Name: Davey Rand<br>R&D Scientist]] | ||
|} | |} | ||
=LAB 1 WRITE-UP= | =LAB 1 WRITE-UP= | ||
<br>DISCLAIMER: ALL GROUP MEMBERS PARTICIPATED EQUALLY IN THE WRITING OF REPORTS. SOME OF US HAD ISSUES LOGGING IN SO CONTRIBUTIONS MAY NOT APPEAR TO ADD UP APPROPRIATELY. | |||
==Initial Machine Testing== | ==Initial Machine Testing== | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
[[Image: | [[Image:BME103_Group2_PCRMachine.png|200px|OpenPCR Machine]]<br> | ||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
When we unplugged part mounting plate from circuit board, | When we unplugged part mounting plate from circuit board, Machine #2 had no visible screen and we could not see the the information on the LCD screen. | ||
When we unplugged the white wire that connects the circuit board to the sample holder, the machine's temperature was unable to be monitored and could not be regulated | When we unplugged the white wire that connects the circuit board to the sample holder, the machine's temperature was unable to be monitored and could not be regulated. | ||
'''Test Run''' | '''Test Run''' | ||
Our group did our test run on October 24, 2012. During the test run, we ran into no problems with | Our group did our test run on October 24, 2012. During the test run, we ran into no problems with Machine #2. We were done and found our results in a matter of 1 to 2 hours. The Open PCR machine was connected to one computer to control the temperature of each cycle of PCR during the experimental. | ||
Line 50: | Line 50: | ||
'''Polymerase Chain Reaction'''<br> | '''Polymerase Chain Reaction'''<br> | ||
How PCR Works: | How PCR Works:<br> | ||
Step 1: Denaturation by Heat | |||
Step 2: Annealing Primer to Target Sequence | Step 1: Denaturation by Heat <br> | ||
Step 3: Extension | Initially, heat separates a DNA strand into two separate strands. This is allowed because the hydrogen bonds that hold the DNA together are weak and easily separable when heated. <br> | ||
Step 2: Annealing Primer to Target Sequence<br> | |||
We want to target a sequence specifically and in order to accomplish that you must use primers. Primers mark the end of the target sequence. Two primers are included in the PCR; one for each of the strands that were just separated during denaturation. The beginning of the DNA target sequence is also marked by the primers that bind (anneal) to the complementary sequence. <br> | |||
Step 3: Extension<br> | |||
After the primers bind to the complementary DNA, the temperature is raised and the enzyme Taq DNA polymerase is used to replicate the strands. The Taq DNA polymerase, active at high temperatures, facilitates the binding and joining of the complementary nucleotides. It synthesizes an identical double-stranded DNA strand. Extension begins at the 3’ end of the primer because Taq DNA polymerase synthesizes exclusively in the 5’ to 3’ direction, so the free nucleotides are only added to the 3’ end of the primer. | |||
<br> | <br> | ||
How to Amplify a Patient’s DNA sample | |||
1. A PCR Machine is created to amplify a patient’s DNA sample. In order to use a PCR machine, | How to Amplify a Patient’s DNA sample: <br> | ||
2. The frozen DNA samples are | |||
3. Once the samples | 1. A PCR Machine is created to amplify a patient’s DNA sample. In order to use a PCR machine, one must first gather the DNA samples, 50 μL each. <br> | ||
2. The frozen DNA samples are placed into separate tubes and once melted, 8 transfer pipettes are used to add primer. <br> | |||
3. Once the samples were ready, we processed the DNA in the openPCR system. <br> | |||
<br> | <br> | ||
Components of the PCR master mix | Components of the PCR master mix:<br> | ||
400μM dATP, 400μM dGTP, 400μM dCTP, 400μM dTTP and 3mM MgCl2, reaction buffer (pH 8.5), nuclease-free water | |||
<br> | <br> | ||
'''Flourimeter Measurements'''<br> | '''Flourimeter Measurements'''<br> | ||
Line 71: | Line 80: | ||
<br><br> | <br><br> | ||
Fluorimeter assembly procedure: Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while | Fluorimeter assembly procedure: <br> | ||
Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while maintaining the ability to use the smart phone to take pictures. | |||
<br> | <br> | ||
How to open images in Image J | How to open images in Image J:<br> | ||
Save the pictures to the phone. Download the pictures onto a computer that has Image J. Open them with Image J by going to add image. | |||
==Research and Development== | ==Research and Development== | ||
Line 90: | Line 103: | ||
'''Cancer-Sequence Primer:''' TTGAGAATGTGACGTATGTA<br> | '''Cancer-Sequence Primer:''' TTGAGAATGTGACGTATGTA<br> | ||
'''"Partner Primer":''' 29,121,080<br> | '''"Partner Primer":''' 29,121,080<br> | ||
'''Description of Gene:'''<br> | |||
"In response to DNA damage and replication blocks, cells prevent cell cycle progression through the control of critical cell cycle regulators. To investigate checkpoint conservation, Matsuoka et al. (1998) used PCR and database analysis to identify CHK2, the mammalian homolog of Saccharomyces cerevisiae Rad53 and Schizosaccharomyces pombe cds1+, protein kinases required for DNA damage and replication checkpoints. The longest human cDNA encoded a 543-amino acid protein with 83% identity to mouse Chk2 and 34% identity to Drosophila Dmnk, a protein highly expressed in ovaries for which a function in meiosis had been suggested. Human CHK2 protein is 26% identical to Rad53 and 26% identical to cds1+. Sequence analysis revealed a single forkhead-associated (FHA) domain, a 60-amino acid protein interaction domain essential for activation in response to DNA damage that is conserved in the Rad53/cds1+ family of kinases. CHK2 has a potential regulatory region rich in SQ and TQ amino acid pairs. Northern blot analysis revealed wide expression of small amounts of CHK2 mRNA with larger amounts in human testis, spleen, colon, and peripheral blood leukocytes. CHK2 complemented the lethality of a Rad53 deletion."<br> | |||
Source: http://omim.org/entry/604373?search=CHEK2&highlight=chek2 | |||
'''Normal Gene Sequence:'''<br> | '''Normal Gene Sequence:'''<br> | ||
Line 109: | Line 125: | ||
==Results== | ==Results== | ||
Water<br> | |||
Water | [[Image:waterdrop-BME103-Group2.png|200px|Water]]<br> | ||
Calf Thymus<br> | |||
[[Image:ImageJ-BME103-Group2.png|200px|DNA]]<br> | |||
<!--- Place two small images here. One showing Water in Image J and one showing Calf Thymus DNA ---> | <!--- Place two small images here. One showing Water in Image J and one showing Calf Thymus DNA ---> | ||
<!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | <!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | ||
{| {{table}} | {| {{table}} | ||
Line 130: | Line 137: | ||
| '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | | '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | ||
|- | |- | ||
| PCR: Negative Control || | | PCR: Negative Control || 218527 || 0 || Water | ||
|- | |- | ||
| PCR: Positive Control || | | PCR: Positive Control || 6369082 || 2 || Calf Thymus | ||
|- | |- | ||
| PCR: Patient 1 ID | | PCR: Patient 1 ID 43825 Female Age:53, rep 1 || 1193961 || 0 || negative | ||
|- | |- | ||
| PCR: Patient 1 ID | | PCR: Patient 1 ID 43825 Female Age:53, rep 2 || 5237029 || 1.1 || negative | ||
|- | |- | ||
| PCR: Patient 1 ID | | PCR: Patient 1 ID 43825 Female Age:53, rep 3 || 5437872 || 1.2 || negative | ||
|- | |- | ||
| PCR: Patient 2 ID | | PCR: Patient 2 ID 12079 Female Age:56, rep 1 || 10726518 || 4 || positive | ||
|- | |- | ||
| PCR: Patient 2 ID | | PCR: Patient 2 ID 12079 Female Age:56, rep 2 || 2711977 || 0.7 || negative | ||
|- | |- | ||
| PCR: Patient 2 ID | | PCR: Patient 2 ID 12079 Female Age:56, rep 3 || 7637000 || 2.2 || positive | ||
|} | |} | ||
Latest revision as of 17:05, 10 December 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP
Initial Machine Testing
When we unplugged part mounting plate from circuit board, Machine #2 had no visible screen and we could not see the the information on the LCD screen. When we unplugged the white wire that connects the circuit board to the sample holder, the machine's temperature was unable to be monitored and could not be regulated.
Our group did our test run on October 24, 2012. During the test run, we ran into no problems with Machine #2. We were done and found our results in a matter of 1 to 2 hours. The Open PCR machine was connected to one computer to control the temperature of each cycle of PCR during the experimental.
ProtocolsPolymerase Chain Reaction How PCR Works: Step 1: Denaturation by Heat
1. A PCR Machine is created to amplify a patient’s DNA sample. In order to use a PCR machine, one must first gather the DNA samples, 50 μL each.
400μM dATP, 400μM dGTP, 400μM dCTP, 400μM dTTP and 3mM MgCl2, reaction buffer (pH 8.5), nuclease-free water
Fluorimeter assembly procedure: Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while maintaining the ability to use the smart phone to take pictures.
How to open images in Image J: Save the pictures to the phone. Download the pictures onto a computer that has Image J. Open them with Image J by going to add image. Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Cancer Associated with the gene: Breast and Colorectal cancer with a susceptibility to LiFraumeni Syndrome Source: http://omim.org/entry/604373?search=CHEK2&highlight=chek2
Cancer Gene Sequence: Baye's Rule:
Results
|