OUR TEAM
Name: Susan Sajadi Role(s) Open PCR Machine Engineer
| Name: Rachel Lundeen Role(s)Research and Development
| Name: Elizabeth Lopez Role(s) Experimental Protocol Planner
| Name: Britny Sepulveda Role(s)Experimental Protocol Planner
| Name: Raymond Feliciano Role(s)Open PCR Machine Engineer
| Name: Colin Siguenza Role(s) Research and Development
| Name: Rotem Beger Role(s)Experimental Protocol Planner
| Name: Lars Moss Role(s)Research and Development
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system .
System Design
PCR Heating Block
Key Features
PCR Heating Block
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.
Benefit and Function
The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate
Heat Sink/Fan/etc
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.
Benefit and Function
Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.
Instructions
In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow. Also, many of the pieces will be larger and easier to handle than previous designs. The materials will also be different, however they will have the same function.
Protocols
Materials
| Supplied in the Kit
| Amount
|
| PCR Machine | 1
|
| Hydrophobic Slides | 24
|
| Plastic Phone Holder | 8
|
| Fluorimeter | 8
|
| Supplied By User
| Amount
|
| Smartphone with Camera | 8
|
| DNA Samples | 1600 μL
|
| Black Box | 8
|
| Green Dye | 8 mL
|
| Computer | 8
|
| Image J Software | 8
|
| Open PCR | 1
|
| Epindorf Tubes | 32
|
| Pipettes | 10
|
| Reagent
| Volume
|
| Template DNA (20 ng) | 0.2 μL
|
| 10 μM forward primer | 1.0 μL
|
| 10 μM reverse primer | 1.0 μL
|
| GoTaq master mix | 50.0 μL
|
| dH2O | 47.8 μL
|
| Total Volume | 100.0 μL
|
PCR Protocol
The PCR machine is color coded by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, utilizing two different samples, a positive control, and a negative control. The students will then place their test tubes into their assigned colored row and the teacher will close the lid and start the program. Students will run this for two hours so that the PCR machine can amplify the DNA samples for 30-35 cycles, depending on the teacher's discretion and time constraints.
Flourimeter Setup:
1. Place the glass slide onto the device.
2. Turn on the blue light and move the slide so that the light is positioned between two of the dots on the slide.
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically not horizontally or side by side.
4. Place the phone in the holder close enough to the device to get a close and accurate picture.
5. Place the box over the device and phone holder.
6. Close the box as much as possible and take a picture.
DNA Measurement Protocol
ImageJ Procedure:
1. Open up the image.
2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same.
3. Split the channels, by going under the tab Image, and then select Color. This will split the file into three files, one of which will be labeled as a green channel.
4. Select the green image and then select the oval selection tool.
5. Draw an oval around the droplet in the image and select Measure under the Analyze tab.
6. The same oval can me moved to the background of the image. Then select Measure.
7. Record all values, or save them as an excel file in ImageJ.
8. Repeat all steps for each image.
Research and Development
Background on Disease Markers
There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].
Primer Design
Forward Primer for Type 2 Diabetes: GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes: GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia: ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia: CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC
Illustration
|