BME103:W930 Group10 l2

From OpenWetWare

Revision as of 01:19, 28 November 2012 by Rachel Lundeen (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Susan SajadiRole(s)
Name: Susan Sajadi
Role(s)
Name: Rachel LundeenRole(s)Research and Development
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth LopezRole(s)
Name: Elizabeth Lopez
Role(s)
Name: Britny SepulvedaRole(s)
Name: Britny Sepulveda
Role(s)
Name: Raymond FelicianoRole(s)
Name: Raymond Feliciano
Role(s)
Name: Colin SiguenzaRole(s)
Name: Colin Siguenza
Role(s)
Name: Rotem BegerRole(s)
Name: Rotem Beger
Role(s)
Name: Lars MossRole(s)
Name: Lars Moss
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
The design includes a color coordinated tray and a larger size in order to make Open PCR easier for a class of students.


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers


There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].


Primer Design


Forward Primer for Type 2 Diabetes:
GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes:
GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia:
ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia:



Illustration


Personal tools