BME103:W930 Group10 l2 - Revision history

Elizabeth Lopez: /* Thermal Cycler Engineering */

2012-11-28T23:31:48Z

Thermal Cycler Engineering

←Older revision		Revision as of 23:31, 28 November 2012
Line 28:		Line 28:
	==Thermal Cycler Engineering==		==Thermal Cycler Engineering==

-	Our re-design is based upon the [http://openpcr.org Open PCR] system .<br>	+	Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br>

	<center>		<center>

Elizabeth Lopez: /* Thermal Cycler Engineering */

2012-11-28T23:31:23Z

Thermal Cycler Engineering

←Older revision		Revision as of 23:31, 28 November 2012
Line 28:		Line 28:
	==Thermal Cycler Engineering==		==Thermal Cycler Engineering==

-	Our re-design is based upon the [http://openpcr.org Open PCR] system ~~originally designed by Tito Jankowski and Josh Perfetto~~ .<br>	+	Our re-design is based upon the [http://openpcr.org Open PCR] system .<br>

	<center>		<center>

Susan Sajadi: /* Thermal Cycler Engineering */

2012-11-28T17:19:13Z

Thermal Cycler Engineering

←Older revision		Revision as of 17:19, 28 November 2012
Line 40:		Line 40:

	'''Key Features'''<br>		'''Key Features'''<br>
		+	<hr>
	<b>PCR Heating Block</b><br>		<b>PCR Heating Block</b><br>
	The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.		The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.
Line 49:		Line 50:
	These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.		These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.

-	<b>Benefit and Function </b>Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.	+	<b>Benefit and Function </b>
		+	Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.

	'''Instructions'''<br>		'''Instructions'''<br>

Larry L. Moss: /* Research and Development */

2012-11-28T16:41:21Z

Research and Development

←Older revision		Revision as of 16:41, 28 November 2012
Line 170:		Line 170:
	Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br>		Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br>
	Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br>		Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br>
-	Reverse Primer for Insomnia: <br>	+	Reverse Primer for Insomnia: <br> CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC <br>

Susan Sajadi: /* Thermal Cycler Engineering */

2012-11-28T16:41:08Z

Thermal Cycler Engineering

←Older revision		Revision as of 16:41, 28 November 2012
Line 49:		Line 49:
	These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.		These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.

-	<b>Benefit and Function: </b>Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.	+	<b>Benefit and Function </b>Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.

	'''Instructions'''<br>		'''Instructions'''<br>

Susan Sajadi: /* Thermal Cycler Engineering */

2012-11-28T16:40:51Z

Thermal Cycler Engineering

←Older revision		Revision as of 16:40, 28 November 2012
Line 48:		Line 48:
	<b>Heat Sink/Fan/etc</b><br>		<b>Heat Sink/Fan/etc</b><br>
	These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.		These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.
-	Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.	+
		+	<b>Benefit and Function: </b>Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.

	'''Instructions'''<br>		'''Instructions'''<br>

Raymond Feliciano: /* Thermal Cycler Engineering */

2012-11-28T16:34:37Z

Thermal Cycler Engineering

←Older revision		Revision as of 16:34, 28 November 2012
Line 40:		Line 40:

	'''Key Features'''<br>		'''Key Features'''<br>
-	<b>PCR Heating Block</b> The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.	+	<b>PCR Heating Block</b><br>
		+	The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.

	<b>Benefit and Function</b><br>		<b>Benefit and Function</b><br>

Raymond Feliciano: /* Thermal Cycler Engineering */

2012-11-28T16:34:19Z

Thermal Cycler Engineering

←Older revision		Revision as of 16:34, 28 November 2012
Line 35:		Line 35:
	[[Image:Pcrmachineplasticgroup10.jpg]]		[[Image:Pcrmachineplasticgroup10.jpg]]

-	PCR Block	+	PCR Heating Block

	[[Image:Tray10.png]]</center>		[[Image:Tray10.png]]</center>

	'''Key Features'''<br>		'''Key Features'''<br>
-	<b>PCR Block</b> The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.	+	<b>PCR Heating Block</b> The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.

	<b>Benefit and Function</b><br>		<b>Benefit and Function</b><br>

Rachel Lundeen: /* Protocols */

2012-11-28T16:33:55Z

Protocols

←Older revision		Revision as of 16:33, 28 November 2012
Line 105:		Line 105:
	\| Open PCR\|\|1		\| Open PCR\|\|1
	\|-		\|-
-	\| Epindorf Tubes\|\|64	+	\| Epindorf Tubes\|\|32
	\|-		\|-
	\| Pipettes\|\|10		\| Pipettes\|\|10

Raymond Feliciano: /* Thermal Cycler Engineering */

2012-11-28T16:33:47Z

Thermal Cycler Engineering

←Older revision		Revision as of 16:33, 28 November 2012
Line 30:		Line 30:
	Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br>		Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br>

-		+	<center>
	'''System Design'''<br>		'''System Design'''<br>

Line 37:		Line 37:
	PCR Block		PCR Block

-	[[Image:Tray10.png]]	+	[[Image:Tray10.png]]</center>

	'''Key Features'''<br>		'''Key Features'''<br>
-	PCR Block:	+	<b>PCR Block</b> The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.
-	The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.	+
-	Benefit and Function- The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate	+	<b>Benefit and Function</b><br>
		+	The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate

-	Heat Sink/Fan/etc.:	+	<b>Heat Sink/Fan/etc</b><br>
	These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.		These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.
	Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.		Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.

	'''Instructions'''<br>		'''Instructions'''<br>
-	In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow, ~~and~~ the pieces ~~maybe~~ be ~~bigger~~. The materials will also be different, however they will have the same function.	+	In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow. Also, many of the pieces will be larger and easier to handle than previous designs. The materials will also be different, however they will have the same function.

	<!--- From Week 4 exercise --->		<!--- From Week 4 exercise --->