BME103:W930 Group10 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Susan Sajadi Role(s) Name: Rachel Lundeen Role(s)Research and Development Name: Elizabeth Lopez Role(s) Name: Britny Sepulveda Role(s) Name: Raymond Feliciano Role(s) Name: Colin Siguenza Role(s) Name: Rotem Beger Role(s) Name: Lars Moss Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features The design includes a color coordinated tray and a larger size in order to make Open PCR easier for a class of students. Instructions Protocols Materials PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. Primer Design Forward Primer for Type 2 Diabetes: GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA Reverse Primer for Type 2 Diabetes: GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC Forward Primer for Insomnia: ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA Reverse Primer for Insomnia: Illustration