BME103:W930 Group10 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Thermal Cycler Engineering)
Current revision (18:31, 28 November 2012) (view source)
(Thermal Cycler Engineering)
 
(43 intermediate revisions not shown.)
Line 13: Line 13:
{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|-
|-
-
| [[Image:BME103student.jpg|100px|thumb|Name: Susan Sajadi<br>Role(s)]]
+
| [[Image:susansajadi.jpg|100px|thumb|Name: Susan Sajadi<br>Role(s) Open PCR Machine Engineer]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
+
| [[Image:rachellundeen.jpg|100px|thumb|Name: Rachel Lundeen<br>Role(s)Research and Development]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
+
| [[Image:openwetwareliz.jpg|100px|thumb|Name: Elizabeth Lopez<br>Role(s) Experimental Protocol Planner]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
+
| [[Image:Brit.jpg|100px|thumb|Name: Britny Sepulveda<br>Role(s)Experimental Protocol Planner]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
+
| [[Image:RaymondFeliciano.png|100px|thumb|Name: Raymond Feliciano<br>Role(s)Open PCR Machine Engineer]]
 +
| [[Image:Colin.jpg|100px|thumb|Name: Colin Siguenza<br>Role(s) Research and Development]]
 +
| [[Image:Rotem.jpg|100px|thumb|Name: Rotem Beger<br>Role(s)Experimental Protocol Planner]]
 +
| [[Image:science.jpg|100px|thumb|Name: Lars Moss<br>Role(s)Research and Development]]
|}
|}
Line 25: Line 28:
==Thermal Cycler Engineering==
==Thermal Cycler Engineering==
-
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br>
+
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br>
-
 
+
 +
<center>
'''System Design'''<br>
'''System Design'''<br>
 +
[[Image:Pcrmachineplasticgroup10.jpg]]
 +
PCR Heating Block
 +
 +
[[Image:Tray10.png]]</center>
'''Key Features'''<br>
'''Key Features'''<br>
-
The design includes a color coordinated tray and a larger size in order to make Open PCR easier for a class of students.  
+
<hr>
 +
<b>PCR Heating Block</b><br>
 +
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.
 +
 
 +
<b>Benefit and Function</b><br>
 +
The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate
 +
<b>Heat Sink/Fan/etc</b><br>
 +
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.
-
'''Instructions'''<br>
+
<b>Benefit and Function </b>
 +
Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.
 +
'''Instructions'''<br>
 +
In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow. Also, many of the pieces will be larger and easier to handle than previous designs. The materials will also be different, however they will have the same function. 
<!--- From Week 4 exercise --->
<!--- From Week 4 exercise --->
Line 60: Line 77:
'''Materials'''
'''Materials'''
-
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here --->
+
<!--- Place your two tables "Supplied in the Kit" and "Supplied by User" here --->
 +
{|
 +
| align="center" style="background:#f0f0f0;"|'''Supplied in the Kit'''
 +
| align="center" style="background:#f0f0f0;"|'''Amount'''
 +
|-
 +
| PCR Machine||1
 +
|-
 +
| Hydrophobic Slides||24
 +
|-
 +
| Plastic Phone Holder||8
 +
|-
 +
| Fluorimeter||8
 +
|}
 +
{|
 +
| align="center" style="background:#f0f0f0;"|'''Supplied By User'''
 +
| align="center" style="background:#f0f0f0;"|'''Amount'''
 +
|-
 +
| Smartphone with Camera||8
 +
|-
 +
| DNA Samples||1600 μL
 +
|-
 +
| Black Box||8
 +
|-
 +
| Green Dye||8 mL
 +
|-
 +
| Computer||8
 +
|-
 +
| Image J Software||8
 +
|-
 +
| Open PCR||1
 +
|-
 +
| Epindorf  Tubes||32
 +
|-
 +
| Pipettes||10
 +
|}
 +
 +
{|
 +
| align="center" style="background:#f0f0f0;"|'''Reagent'''
 +
| align="center" style="background:#f0f0f0;"|'''Volume'''
 +
|-
 +
| Template DNA (20 ng)||0.2 μL
 +
|-
 +
| 10 μM forward primer||1.0 μL
 +
|-
 +
| 10 μM reverse primer||1.0 μL
 +
|-
 +
| GoTaq master mix||50.0 μL
 +
|-
 +
| dH2O||47.8 μL
 +
|-
 +
| Total Volume||100.0 μL
 +
|}
'''PCR Protocol'''
'''PCR Protocol'''
 +
<br> The PCR machine is color coded by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, utilizing two different samples, a positive control, and a negative control. The students will then place their test tubes into their assigned colored row and the teacher will close the lid and start the program. Students will run this for two hours so that the PCR machine can amplify the DNA samples for 30-35 cycles, depending on the teacher's discretion and time constraints.
-
 
+
Flourimeter Setup: <br>
-
 
+
1. Place the glass slide onto the device.<br>
 +
2. Turn on the blue light and move the slide so that the light is positioned between two of the dots on the slide.<br>
 +
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically '''not''' horizontally or side by side.<br>
 +
4. Place the phone in the holder close enough to the device to get a close and accurate picture.<br>
 +
5. Place the box over the device and phone holder.<br>
 +
6. Close the box as much as possible and take a picture.
'''DNA Measurement Protocol'''
'''DNA Measurement Protocol'''
-
 
+
ImageJ Procedure:<br>
-
 
+
1. Open up the image. <br>
 +
2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same. <br>
 +
3. Split the channels, by going under the tab Image, and then select Color. This will split the file into three files, one of which will be labeled as a green channel. <br>
 +
4. Select the green image and then select the oval selection tool. <br>
 +
5. Draw an oval around the droplet in the image and select Measure under the Analyze tab. <br>
 +
6. The same oval can me moved to the background of the image. Then select Measure.<br>
 +
7. Record all values, or save them as an excel file in ImageJ. <br>
 +
8. Repeat all steps for each image. <br>
==Research and Development==
==Research and Development==
Line 81: Line 162:
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
-
 
+
There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=4402960#fasta]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315403].
-
 
+
Line 88: Line 168:
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
 +
 +
Forward Primer for Type 2 Diabetes: <br> GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA<br>
 +
Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br>
 +
Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br>
 +
Reverse Primer for Insomnia: <br> CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC <br>
Line 95: Line 180:
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
-
 
+
[[Image:PCR.gif ]]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Current revision

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Susan SajadiRole(s) Open PCR Machine Engineer
Name: Susan Sajadi
Role(s) Open PCR Machine Engineer
Name: Rachel LundeenRole(s)Research and Development
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth LopezRole(s) Experimental Protocol Planner
Name: Elizabeth Lopez
Role(s) Experimental Protocol Planner
Name: Britny SepulvedaRole(s)Experimental Protocol Planner
Name: Britny Sepulveda
Role(s)Experimental Protocol Planner
Name: Raymond FelicianoRole(s)Open PCR Machine Engineer
Name: Raymond Feliciano
Role(s)Open PCR Machine Engineer
Name: Colin SiguenzaRole(s) Research and Development
Name: Colin Siguenza
Role(s) Research and Development
Name: Rotem BegerRole(s)Experimental Protocol Planner
Name: Rotem Beger
Role(s)Experimental Protocol Planner
Name: Lars MossRole(s)Research and Development
Name: Lars Moss
Role(s)Research and Development

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Tito Jankowski and Josh Perfetto .

System Design

Image:Pcrmachineplasticgroup10.jpg

PCR Heating Block

Image:Tray10.png

Key Features


PCR Heating Block
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.

Benefit and Function
The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate

Heat Sink/Fan/etc
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.

Benefit and Function Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.

Instructions
In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow. Also, many of the pieces will be larger and easier to handle than previous designs. The materials will also be different, however they will have the same function.




Protocols

Materials

Supplied in the Kit Amount
PCR Machine1
Hydrophobic Slides24
Plastic Phone Holder8
Fluorimeter8
Supplied By User Amount
Smartphone with Camera8
DNA Samples1600 μL
Black Box8
Green Dye8 mL
Computer8
Image J Software8
Open PCR1
Epindorf Tubes32
Pipettes10
Reagent Volume
Template DNA (20 ng)0.2 μL
10 μM forward primer1.0 μL
10 μM reverse primer1.0 μL
GoTaq master mix50.0 μL
dH2O47.8 μL
Total Volume100.0 μL

PCR Protocol
The PCR machine is color coded by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, utilizing two different samples, a positive control, and a negative control. The students will then place their test tubes into their assigned colored row and the teacher will close the lid and start the program. Students will run this for two hours so that the PCR machine can amplify the DNA samples for 30-35 cycles, depending on the teacher's discretion and time constraints.

Flourimeter Setup:
1. Place the glass slide onto the device.
2. Turn on the blue light and move the slide so that the light is positioned between two of the dots on the slide.
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically not horizontally or side by side.
4. Place the phone in the holder close enough to the device to get a close and accurate picture.
5. Place the box over the device and phone holder.
6. Close the box as much as possible and take a picture.

DNA Measurement Protocol

ImageJ Procedure:
1. Open up the image.
2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same.
3. Split the channels, by going under the tab Image, and then select Color. This will split the file into three files, one of which will be labeled as a green channel.
4. Select the green image and then select the oval selection tool.
5. Draw an oval around the droplet in the image and select Measure under the Analyze tab.
6. The same oval can me moved to the background of the image. Then select Measure.
7. Record all values, or save them as an excel file in ImageJ.
8. Repeat all steps for each image.

Research and Development

Background on Disease Markers

There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].


Primer Design


Forward Primer for Type 2 Diabetes:
GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes:
GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia:
ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia:
CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC



Illustration

Image:PCR.gif

Personal tools