BME103:W930 Group10 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Protocols)
Line 72: Line 72:
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here --->
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here --->
 +
{|
 +
| align="center" style="background:#f0f0f0;"|'''Supplied in Kit'''
 +
| align="center" style="background:#f0f0f0;"|'''Amount'''
 +
|-
 +
| PCR Machine||1
 +
|-
 +
| Hydrophobic Slides||24
 +
|-
 +
| Plastic Phone Holder||8
 +
|-
 +
| Fluorimeter||8
 +
|}
 +
{|
 +
| align="center" style="background:#f0f0f0;"|'''Supplied By User'''
 +
| align="center" style="background:#f0f0f0;"|'''Amount'''
 +
|-
 +
| Smartphone with Camera||8
 +
|-
 +
| DNA Samples||16
 +
|-
 +
| Black Box||8
 +
|-
 +
| Green Dye||8
 +
|-
 +
| Computer||8
 +
|-
 +
| Image J Software||8
 +
|-
 +
| Open PCR||8
 +
|-
 +
| Test Tubes||16
 +
|-
 +
| Pippete||8
 +
|}
'''PCR Protocol'''
'''PCR Protocol'''
Line 80: Line 114:
'''DNA Measurement Protocol'''
'''DNA Measurement Protocol'''
-
 
-
 
-
 
==Research and Development==
==Research and Development==

Revision as of 02:47, 28 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Susan SajadiRole(s)
Name: Susan Sajadi
Role(s)
Name: Rachel LundeenRole(s)Research and Development
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth LopezRole(s)
Name: Elizabeth Lopez
Role(s)
Name: Britny SepulvedaRole(s)
Name: Britny Sepulveda
Role(s)
Name: Raymond FelicianoRole(s)
Name: Raymond Feliciano
Role(s)
Name: Colin SiguenzaRole(s)
Name: Colin Siguenza
Role(s)
Name: Rotem BegerRole(s)
Name: Rotem Beger
Role(s)
Name: Lars MossRole(s)
Name: Lars Moss
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
PCR Block: The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. Benefit and Function- The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate

Heat Sink/Fan: These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.



Instructions





Protocols

Materials

Supplied in Kit Amount
PCR Machine1
Hydrophobic Slides24
Plastic Phone Holder8
Fluorimeter8
Supplied By User Amount
Smartphone with Camera8
DNA Samples16
Black Box8
Green Dye8
Computer8
Image J Software8
Open PCR8
Test Tubes16
Pippete8

PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].


Primer Design


Forward Primer for Type 2 Diabetes:
GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes:
GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia:
ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia:



Illustration

Image:PCR.gif

Personal tools