BME103:W930 Group10 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 91: Line 91:
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
Forward Primer for Type 2 Diabetes: <br> GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA<br>
Reverse Primer for Insomnia: <br>

Revision as of 02:08, 28 November 2012

BME 103 Fall 2012 Home
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Wiki Editing Help



Name: Susan SajadiRole(s)
Name: Susan Sajadi
Name: Rachel LundeenRole(s)Research and Development
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth LopezRole(s)
Name: Elizabeth Lopez
Name: Britny SepulvedaRole(s)
Name: Britny Sepulveda
Name: Raymond FelicianoRole(s)
Name: Raymond Feliciano
Name: Colin SiguenzaRole(s)
Name: Colin Siguenza
Name: Rotem BegerRole(s)
Name: Rotem Beger
Name: Lars MossRole(s)
Name: Lars Moss


Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.

System Design

Key Features
The design includes a color coordinated tray and a larger size in order to make Open PCR easier for a class of students.




PCR Protocol

DNA Measurement Protocol

Research and Development

Background on Disease Markers

There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood.

Primer Design

Forward Primer for Type 2 Diabetes:
Reverse Primer for Type 2 Diabetes:
Forward Primer for Insomnia:
Reverse Primer for Insomnia:


Personal tools