BME103:W930 Group10

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Susan Sajadi Role(s): Open PCR Machine Engineer Name: Raymond Feliciano Role(s): Open PCR Machine Engineer Name: Britny Sepulveda Role(s): Experimental Protocol Planner Name: Rachel Lundeen Role(s): R&D Scientist Name: Elizabeth Lopez Role(s): Experimental Protocol Planner Name: Larry Moss Role(s): R&D Scientist Name: Collin Siguenza Role(s): R&D Scientist Name: Rotem Berger Role(s): Experimental Protocol Planner LAB 1 WRITE-UP Initial Machine Testing The Original Design This is the OpenPCR machine utilized to automate polymerase chain reactions. This reaction allows for the amplification of specific DNA which is useful for detecting different markers, such as those indiciating an increased risk for cancer, presence of HIV, etc. Experimenting With the Connections When we unplugged the LCD screen from the Open PCR circuit board, the machine's LCD screen did not turn on. When we unplugged the white wire that connects Open PCR circuit board to the heat sink, there appeared to be no effect, however, it is likely that the heat sink would not function during a trial. Test Run On Oct. 24th, 2012, we first used the Open PCR machine to run 25 cycles on eight samples which included two sets of three samples and a positive and negative control. The process was successful, taking about 90 minutes for the reaction to complete. Initial testing of the device indicated that the machine and software were synced in regards to the temperature during each cycle. Protocols Polymerase Chain Reaction 1. Polymerase Chain Reaction(PCR) works by using a mix of enzymes that transcribe sections of DNA. The enzyme mix is combined with patient DNA. Then, the sample is heated and cooled in regular cycles to match the ideal temperatures for the different enzymes. This will result in replication of the specific section of DNA that is being tested. 2. Steps to amplify a patient's DNA sample 1. Add 50 microliters PCR master mix of enzymes to patient DNA sample 2. Put in PCR machine 3. Run for the prescribed number of cycles Reagent Table Volume Template DNA (20ng) 0.2 uL 10 uM forward primer 1.0 uL 10 uM reverse primer 1.0 uL GoTaq master mix 50.0 uL dH2O 47.8 uL Total Volume 100.0 uL Fluorescent Measurements Flourimeter Setup: 1. Place the glass slide onto the device. 2. Turn on the blue light and move the slide to have the light positioned between two of the dots on the slide. 3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. 4. Place the phone in the holder close enough to the device to get a close picture. 5. Place the box over the device and phone holder. 6. Close the box as much as possible and take picture. Research and Development Specific Cancer Marker Detection - The Underlying Technology The NCBI database allows for genes to be searched through in order to determine different mutations and information about them. In this lab, we looked up CHEK2 as it related to rs17879961, a human gene, in the Short Genetic Variations database. CHEK2 is checkpoint kinase 2 which happens in response to DNA damage. Through the database, it was found that a missense mutation occured in the 22nd chromosome. The primer of the cancer sequence is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC and the reverse primer to this would be AACTCTTACACTGCATACAT. The mutation for cancer changes the codon "ATT" to "ACT" in the DNA sequence. This change codes for cancers such as breast and colorectal cancer. The reason why cancer mutations give a positive PCR signal, while a non-cancer sequence gives no signal, is a result of the primer that attaches to the sequence. The primer is coded for the specific codon "ACT" and will only attach if the sequence is such, which then allows the Taq Polymerase to bind and replicate the DNA exponentially. If the primer sees that the codon is "ATT," it will not bind and therefore will not replicate and cause the PCR signal to be positive. In this lab, the samples that exhibited the fluorescent dye were the ones in which the PCR signal was positive and therefore had cancer. Baye's Rule is used to determine the probability that a person has cancer or not. In a study of 180 people, 1.1% have the mutation for cancer while 98.9% do not. Using Baye's rule, it was found that 7.8% should have cancer. The formula for Baye's Rule is p (hc|C) = p(C|hc) p(hc) / p(C) For an animated walkthrough of the process, check out this PCR Virtual Lab from the team at the University of Utah's Genetic Science Learning Center Results Data Measured via ImageJ Sample ID Area & x,y,w,h info Mean Pixel Value INTDEN RAWINTDEN INTDEN 110927 Sample 28072 65.2 18311650 18311650 110927 Background 28072 4.359 122377 122377 110501 Sample 28768 119.163 3428070 3428070 110501 Background 28768 2.39 68746 68746 1110252 Sample 27024 123.912 3348606 3348606 1110252 Background 27024 4.782 129231 129231 110052 Sample 23072 107.179 2472834 2472834 110052 Background 23072 3.558 82088 82088 105842 Sample 25784 66.01 1701990 1701990 105842 Background 25784 5.104 131592 131592 11121 Sample 5120 86.627 443529 443529 11121 Background 5120 4.591 23505 23505 111314 Sample 6908 52.91 365499 365499 111314 Background 6908 3.319 21685 21685 1115585 Sample 5812 112.53 654023 654023 111558 Background 5812 5.567 32358 32358 Sample ID INTDEN with background subtracted 110927 18189273 110501 3359324 1110252 3219375 110052 2390746 105842 1570398 11121 420024 111314 343814 1115585 621665 Green Channel With DNA Green Channel With Water Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control E6 F6 G6 PCR: Positive Control E7 F7 G7 PCR: Patient 1 ID #####, rep 1 E8 F8 G8 PCR: Patient 1 ID #####, rep 2 E9 F9 G9 PCR: Patient 1 ID #####, rep 3 E10 F10 G10 PCR: Patient 2 ID #####, rep 1 E11 F11 G11 PCR: Patient 2 ID #####, rep 2 E12 F12 G12 PCR: Patient 2 ID #####, rep 3 E13 F13 G13 KEY Sample = Integrated Density = DNA μg/mL = Conclusion =

Works Cited

"Microbial Chatter." - Thermus Aquaticus. N.p., n.d. Web. 31 Oct. 2012. <http://docp.edublogs.org/thermus-aquaticus/>.

"Replication." Shmoop. N.p., n.d. Web. 31 Oct. 2012. <http://www.shmoop.com/dna/dna-replication.html>.