BME103:W930 Group1: Difference between revisions
Zhiyue Yang (talk | contribs) |
Zhiyue Yang (talk | contribs) |
||
Line 26: | Line 26: | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
[[Image: | [[Image:Open PCR.png]])<br> | ||
Original design of the Open PCR machine showing inner mechanisms. As the image shows, this Open PCR machine primarily consists of 5 parts, which are LCD screen, heating lid, heater, circuit board and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws. | Original design of the Open PCR machine showing inner mechanisms. As the image shows, this Open PCR machine primarily consists of 5 parts, which are LCD screen, heating lid, heater, circuit board and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws. | ||
Revision as of 20:27, 13 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When we unplugged part LCD screen from the circuit board, the machine's screen stopped displaying. When we unplugged the white wire that connects the circuit board to the heated lid, the machine stopped controlling the temperature.
During our first test run on October 24, 2012, the machine's fan would not work and therefore we could not complete the DNA replication.
ProtocolsPolymerase Chain Reaction How PCR Works Thermal Cycling Components of the PCR master mix • 2X Colorless Go Taq ® Reaction Buffer (pH 8.5)
Positive Control Negative Control Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Insert image here
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
|