BME103:W930 Group1: Difference between revisions
Kevin M. Chu (talk | contribs) |
|||
Line 189: | Line 189: | ||
| PCR: Patient 1 ID 92336, rep 3 || 65596983 || 2.3854 || Positive | | PCR: Patient 1 ID 92336, rep 3 || 65596983 || 2.3854 || Positive | ||
|- | |- | ||
| PCR: Patient 2 ID 44606, rep 1 || 10866235 || 0.3951 || | | PCR: Patient 2 ID 44606, rep 1 || 10866235 || 0.3951 || Positive | ||
|- | |- | ||
| PCR: Patient 2 ID 44606, rep 2 || 16970600 || 0.6171 || | | PCR: Patient 2 ID 44606, rep 2 || 16970600 || 0.6171 || Positive | ||
|- | |- | ||
| PCR: Patient 2 ID 44606, rep 3 || 12971264 || 0.4717 || | | PCR: Patient 2 ID 44606, rep 3 || 12971264 || 0.4717 || Positive | ||
|} | |} | ||
Line 201: | Line 201: | ||
* '''Integrated Density''' = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background. | * '''Integrated Density''' = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background. | ||
* '''DNA μg/mL''' = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus. | * '''DNA μg/mL''' = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus. | ||
* '''Conclusion''' = Each calculated DNA concentration was compared to the concentrations of both the negative and positive controls. The samples with concentrations | * '''Conclusion''' = Each calculated DNA concentration was compared to the concentrations of both the negative and positive controls. The samples with concentrations less than the negative result produced no signal while the those with concentrations greater than the negative control produced a positive test for cancer. However, the DNA concentration for patient one was closer to the positive control while the DNA concentration for patient two is closer to (but still greater than) the positive control. The conclusion is that patient one most likely has cancer while patient two probably does not have cancer. | ||
Revision as of 10:23, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
All members of the group participated within their respective roles and contributed to the content of this page. Bri Ackerman, Haley Parrott, and Michael Dennison did not have their accounts verified by the time this page was submitted, therefore their names will not show up in the editing history.
LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections Test Run
ProtocolsPolymerase Chain Reaction Thermal Cycling Components of the PCR master mix Reagent and Volume of DNA Solution
Description of DNA Samples Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Flourimeter Assembly and Experiment Procedure ImageJ Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA [C/T] TGCATACATAGAAGATCAGAGTGGC. The allele change is from T to C, meaning that when the T base pair mutates into a C base pair, the cancer sequence is expressed. The gene being affected in this mutation is checkpoint kinase 2 (CHK2). Detection of this gene mutation is achieved through a process called polymerase chain reaction (PCR), which is a technology that amplifies a single copy of DNA to generate a multitude of that specific sequence. This allows scientists and researches to isolate a specific DNA sequence in order to compare it to a specific phenotype, which in this case is the presence of colorectal cancer. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate (location) of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene in the SNP. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, when the probability of expressing the "C" gene and also having cancer is 7.8%: The probability of having cancer and also expressing the "C" gene = 1.1%
Results
|