BME103:W930 Group1: Difference between revisions
Kevin M. Chu (talk | contribs) |
Kevin M. Chu (talk | contribs) |
||
Line 177: | Line 177: | ||
KEY | KEY | ||
* '''Sample''' = | * '''Sample''' = Each sample is a solution of amplified DNA obtained via PCR. The first two rows of the table display the negative and positive controls. Rows 3-5 show results for 3 replicates of patient 1, and rows 7-9 show 3 replicates of patient 2. | ||
* '''Integrated Density''' = | * '''Integrated Density''' = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background. | ||
* '''DNA μg/mL''' = | * '''DNA μg/mL''' = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus. | ||
* '''Conclusion''' = | * '''Conclusion''' = Each calculated DNA concentration was compared to the concentrations of both the negative and positive controls. The samples with concentrations closer to the negative result produced no signal while the samples with concentrations closer to the positive result produced a positive test for cancer. | ||
Revision as of 22:40, 13 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When we unplugged the LCD screen from the circuit board, the machine's screen stopped displaying. When we unplugged the white wire that connects the circuit board to the heated lid, the machine stopped controlling the temperature.
Our group had machine #1. During our first test run on October 24, 2012, the machine's fan would not work and therefore we could not complete the DNA replication.
ProtocolsPolymerase Chain Reaction How PCR Works Thermal Cycling Components of the PCR master mix • 2X Colorless Go Taq ® Reaction Buffer (pH 8.5)
Positive Control Negative Control Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
|