BME103:T930 Group 9 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Devraj Patel Open PCR Machine Engineer Brandon Simmons Open PCR Machine Engineer Andrew Hensley Experimental Protocol Planner Nathalie Vitale Experimental Protocol Planner Ojeen Korkes Research and Development Scientist LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Open PCR Gen 2 Key Features We introduced two new designs to create a machine that would allow to the PCR machine to be more portable and reduce the need for external equipment besides the machine itself. The first of the two features is a better performing LCD screen with attached four analog buttons on the bottom of screen that allow for the programmer to program the machine and eliminate the need of a computer to program. The four analog buttons will include: Increase, Decrease, Temp/Time, Start/Stop/Restart. These buttons will allow the programmer to prepare a PCR experiment sequence without the use of external equipment, such as a computer equipped with PCR software. These buttons will be placed directly below the LCD screen, so that they can be easily accessible and usable. The second of the two features includes a new internal PCR Board, which is configured with the new LCD screen. Since the programmer will now be able to change the program on the machine itself, the internal PCR Board will have to be modified to allow the program to be stored and set in the PCR Board. The changes that need to be taken with this equipment are to wire the buttons from the LCD screen to the PCR Board, so that the inputs by the user can be recognized by the system and the PCR board will also need a new program implemented into the system that can understand the user inputs as well. With these small design changes, we will eliminate the reliance on other technologies to operate the machine and increase its overall mobility. Instructions To add these design changes, first, the previous LCD screen would need to be removed and new space must be cut out for the larger screen with attached buttons, underneath the LCD screen space that is already there. Second, the wiring for the new screen must be taken care of for the user's inputs to be read. So, we must attach the new screen to the previous cable attaching the previous LCD screen and create wiring that connects the four buttons to the new PCR board. Thirdly, we must take out the PCR board and install the modified PCR board using previous mounting spots, allowing for the program to be set and stored in the internal memory of the new PCR board. Remembering to install the new wiring with both the new LCD screen and the analog buttons, we can reassemble machine and test for operating efficiency. Protocols Materials Supplied in the kit Material Amount Open PCR Machine 1 Mircopipette 1 Sets of PCR Tubes (containing 6 individual tubes) 8 (replaced as needed by user) Reagent* 1000μL Electrical cord 1 Reagent* Volume Template DNA (20 ng) 0.2 μL 10 μM Forward Primer 1.0μL 10 μM Reverse Primer 1.0μL GoTaq master mix 50μL dH2O 47.8 μL Total Volume 100.0 μL Supplied by user Material Amount DNA samples supplied as needed USB 1 Assembly tools 1 set PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers 1) Emphysema is a lung disease; it causes damage to the small air sacs, alveoli, and small airways in your lungs. This damage obstructs airflow when a patient with Emphysema exhales. “Most emphysema cases are caused by smoking, but about 3 percent of cases are caused by an inherited deficiency in a protein that normally protects the alveoli.” This protein is alpha-1 antitrypsin[1]. Moreover, Emphysema is characterized by loss of elasticity due to the action of alpha-1 antitrypsin deficiency. The marker that is being used is rs709932[2].This SNP is associated with Emphysema due to AAT deficiency. The sequence associated with Emphysema due to AAT deficiency is C(A)T , while a normal sequence is C(G)T, which is located on the 14 chromosome. The gene alteration leads to a mutated human protein. It goes from R[Arg] to H[His]. Emphysema due to AAT deficiency rs709932 Missense CGT→CAT R[Arg]→H[His] Chromosome 14 2) Hemophilia A is an inherited disease that is considered to be a rare blood disorder. It is the most common type of hemophilia. Patients with Hemophilia A suffer longer bleeding and thus, it can damage their tissues and organs. “It is also known as factor VIII deficiency or classic hemophilia.” Sometimes this disease may lead to death. Patients don’t clot normally because a protein needed to form blood clot is missing or reduced. “Approximately one in 5,000 males born in the United States has hemophilia." [3]. The marker that is being used is rs137852466 [4]. This SNP is associated with Hemophilia A. The sequence associated with Hemophilia A is C(G)C , while a normal sequence is C(A)C, which is located on the X chromosome.The gene alteration leads to a mutated human protein. It goes from R[Arg] to H[His]. Hemophilia A rs137852466 Missense CGC→CAC R[Arg]→H[His] Chromosome X Primer Design 1.) Forward primer:5" TTGGCCTCTTCGGTGTCCCC 3" ( at position 75849051 ) Reverse primer: 5" GAACTCCTCC[C]TACCCTCAA 3" 2.) Forward primer:5" TGCTGGTTTTAGCACTGACA 3" (at position 5009175) Reverse primer:5" GCACTCTTC[C]CATGGAGTTG 3" Illustration