BME103:T930 Group 9 l2: Difference between revisions
(14 intermediate revisions by 2 users not shown) | |||
Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:Jasmine.jpg|100px|thumb|Devraj Patel<br>Open PCR Machine Engineer ]] | | [[Image:Jasmine.jpg|100px|thumb|Devraj Patel<br>Open PCR Machine Engineer ]] | ||
| [[Image:Snowwhite.jpg|100px|thumb|Brandon Simmons<br>Open PCR Machine Engineer ]] | | [[Image:Snowwhite.jpg|100px|thumb|Brandon Simmons<br>Open PCR Machine Engineer ]] | ||
Line 29: | Line 29: | ||
'''System Design:'''<br> | '''System Design:'''<br> | ||
'''''Open PCR Gen 2'''<br>'' | '''''Open PCR Gen. 2'''<br>'' | ||
[[Image:BRANDON'S lab 2.png]] | [[Image:BRANDON'S lab 2.png]] | ||
Line 36: | Line 36: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
<br> | <br> | ||
We introduced two new | We introduced two new design features to create a machine that would allow the generation 2 PCR machine to be more portable and reduce the need for external equipment besides the machine itself. | ||
The first of the two features is a better performing LCD screen with attached four analog buttons on the bottom of screen that allow for the programmer to program the machine and eliminate the need of a computer to program. The four analog buttons will include: Increase, Decrease, Temp/Time, Start/Stop/Restart. These buttons will allow the programmer to prepare a PCR experiment sequence without the use of external equipment, such as a computer equipped with PCR software. These buttons will be placed directly below the LCD screen, so that they can be easily accessible and usable. | The first of the two new features is a better performing LCD screen with attached four analog buttons on the bottom of screen that allow for the programmer to program the machine and eliminate the need of a computer to program. The four analog buttons will include: Increase, Decrease, Temp/Time, Start/Stop/Restart. These buttons will allow the programmer to prepare a PCR experiment sequence without the use of external equipment, such as a computer equipped with PCR software. These buttons will be placed directly below the LCD screen, so that they can be easily accessible and usable. | ||
The second of the two features includes a new internal PCR Board, which is configured with the new LCD screen. Since the programmer will now be able to change the program on the machine itself, the internal PCR Board will have to be modified to allow the program to be stored and set in the PCR Board. The changes that need to be taken with this equipment are to wire the buttons from the LCD screen to the PCR Board, so that the inputs by the user can be recognized by the system and the PCR board will also need a new program implemented into the system that can understand the user inputs as well. With these small design changes, we will eliminate the reliance on other technologies to operate the machine and increase its overall mobility. With these small changes it will allow the machine to be used around the world. | The second of the two new features includes a new internal PCR Board, which is configured with the new LCD screen. Since the programmer will now be able to change the program on the machine itself, the internal PCR Board will have to be modified to allow the program to be stored and set in the PCR Board. The changes that need to be taken with this equipment are to wire the buttons from the LCD screen to the PCR Board, so that the inputs by the user can be recognized by the system and the PCR board will also need a new program implemented into the system that can understand the user inputs as well. With these small design changes, we will eliminate the reliance on other technologies to operate the machine and increase its overall mobility. With these small changes it will allow the machine to be used around the world. | ||
<br> | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
<br> | <br> | ||
To add these design changes, first, the previous LCD screen would need to be removed and new space must be cut out for the larger screen with attached buttons, underneath the LCD screen space that is already there. Second, the wiring for the new screen must be taken care of for the user's inputs to be read. So, we must attach the new screen to the previous cable attaching the previous LCD screen and create wiring that connects the four buttons to the new PCR board. Thirdly, we must take out the PCR board and install the modified PCR board using previous mounting spots, allowing for the program to be set and stored in the internal memory of the new PCR board. Remembering to install the new wiring with both the new LCD screen and the analog buttons, we can reassemble machine and test for operating efficiency. <br> | To add these design changes, first, the previous LCD screen would need to be removed and new space must be cut out for the larger screen with attached buttons, underneath the LCD screen space that is already there. Second, the wiring for the new screen must be taken care of for the user's inputs to be read. So, we must attach the new screen to the previous cable attaching the previous LCD screen and create wiring that connects the four buttons to the new PCR board. Thirdly, we must take out the PCR board and install the modified PCR board using previous mounting spots, allowing for the program to be set and stored in the internal memory of the new PCR board. Remembering to install the new wiring with both the new LCD screen and the analog buttons, we can reassemble machine and test for operating efficiency. <br> | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
<br><br> | <br><br> | ||
Line 190: | Line 189: | ||
==Research and Development== | ==Research and Development== | ||
Line 232: | Line 231: | ||
2.) Forward primer:5" TGCTGGTTTTAGCACTGACA 3" (at position 5009175) | 2.) Forward primer:5" TGCTGGTTTTAGCACTGACA 3" (at position 5009175) | ||
<br> Reverse primer:5" GCACTCTTC[ | <br> Reverse primer:5" GCACTCTTC[G]CATGGAGTTG 3" | ||
These primers are designed to be 150 bp apart in order to run the PCR faster than normal, 200 bp, at rate of 10 seconds per cycle. | |||
The disease allele will give a positive result because the primers, forward and revers, are designed specifically to attach only to DNA strand in PCR. On the other hand, a non-disease allele will give a negative result due to the fact that the primers will not attach to the DNA strand in PCR. | |||
Line 239: | Line 244: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:Jej.png]] | |||
[[Image:BME103_2012_classpic2.png]] | [[Image:BME103_2012_classpic2.png]] | ||
[[Image: | |||
<!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | |||
== Bayes’ theorem == | |||
[[Image:Bayes-rule.png]] | |||
P(A):is the probabilities of having a disease <br> | |||
P(B): is the probabilities of non-disease patients who have a positive result<br> | |||
P(A/B): is the probabilities of having a positive result in PCR <br> | |||
P(B/A): is the probabilities of a patients with a disease who have a positive result <br> | |||
Latest revision as of 18:44, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design: Open PCR Gen. 2
The first of the two new features is a better performing LCD screen with attached four analog buttons on the bottom of screen that allow for the programmer to program the machine and eliminate the need of a computer to program. The four analog buttons will include: Increase, Decrease, Temp/Time, Start/Stop/Restart. These buttons will allow the programmer to prepare a PCR experiment sequence without the use of external equipment, such as a computer equipped with PCR software. These buttons will be placed directly below the LCD screen, so that they can be easily accessible and usable. The second of the two new features includes a new internal PCR Board, which is configured with the new LCD screen. Since the programmer will now be able to change the program on the machine itself, the internal PCR Board will have to be modified to allow the program to be stored and set in the PCR Board. The changes that need to be taken with this equipment are to wire the buttons from the LCD screen to the PCR Board, so that the inputs by the user can be recognized by the system and the PCR board will also need a new program implemented into the system that can understand the user inputs as well. With these small design changes, we will eliminate the reliance on other technologies to operate the machine and increase its overall mobility. With these small changes it will allow the machine to be used around the world.
ProtocolsMaterials
Supplied by user
PCR Protocol
DNA Measurement Protocol
How to Open Pictures Using Image J
How to Analyze Pictures in Image J
Research and DevelopmentBackground on Disease Markers
The marker that is being used is rs709932[2].This SNP is associated with Emphysema due to AAT deficiency. The sequence associated with Emphysema due to AAT deficiency is C(A)T , while a normal sequence is C(G)T, which is located on the 14 chromosome. The gene alteration leads to a mutated human protein. It goes from R[Arg] to H[His].
Emphysema due to AAT deficiency
The marker that is being used is rs137852466 [4]. This SNP is associated with Hemophilia A. The sequence associated with Hemophilia A is C(G)C , while a normal sequence is C(A)C, which is located on the X chromosome.The gene alteration leads to a mutated human protein. It goes from R[Arg] to H[His].
Primer Design
These primers are designed to be 150 bp apart in order to run the PCR faster than normal, 200 bp, at rate of 10 seconds per cycle. The disease allele will give a positive result because the primers, forward and revers, are designed specifically to attach only to DNA strand in PCR. On the other hand, a non-disease allele will give a negative result due to the fact that the primers will not attach to the DNA strand in PCR.
Bayes’ theoremP(A):is the probabilities of having a disease
|