From OpenWetWare
BME 103 Fall 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
|
|
OUR TEAM
Devraj Patel Open PCR Machine Engineer and Research and Development Scientist
| Andrew Hensley Experimental Protocol Planner
| Nathalie Vitale Experimental Protocol Planner
| Ojeen Korkes Research and Development Scientist
| Brandon Simmons Open PCR Machine Engineer
|
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design

This is an image of an Open PCR Machine (Polymerase Chain Reaction). This machine amplicifies the DNA by regulating the temperature of the DNA smaples both heating and cooling samples using its temperature regulating parts such as heat sink, fan and heated lid to the preset temperature and for the time set up beforehand using the set up program. This heating and cooling seperates the DNA strands and allows recombination of the DNA to occur with the primers added in the PCR tubes.
Experimenting With the Connections
When we unplugged part 3, the LCD, from part 6, the Open PCR circuit Board, the LCD on the machine turned off and no information appeared on the LCD screen.
When we unplugged the white wire that connects part 6, the Open PCR circuit Board, to part 2, the heat sink, the machine no longer accurately regulates and controls the temperature and result in malfunction of heating the PCR tubes.
Test Run
On October 25, 2012, we conducted our first test on our open PCR machine. We tested the machine to test the operation functionality. The initial test demonstrated the machine heat sink accurately controlled and displayed the preprogrammed temperature determined by the software on the computer. The overall successfullness of the machine was good, however it came with one difficulty, fluctuation of time to complete the preprogrammed cycles.
Protocols
Polymerase Chain Reaction
PCR, polymerase chain reaction, is a simple tool that one can use to focus in onto a segment of DNA and generate thousands to millions of copies of a particular DNA sequence. In PCR, everything relies heavily on the regulation and variation of temperature. By setting the PCR at specific temperatures, a chain of reactions can take place. Therefore, there are three steps in PCR cycle: denaturation, annealing, and extension. In the beginning, PCR should be heated to 95 degrees Celsius. This allows the double-stranded DNA to be separated and unwinded. Secondly, PCR should be cooled at 57 degrees Celsius because this allows a piece of DNA to bind to DNA product from the initial step. This is done through primer enzymes that allow polymerase to start synthesizing by recognizing and attaching to sequences that are complementary. Lastly, the extension step is where DNA product will continually add bases following the primers until it fully synthesize a new strand of DNA. This last step is done at 72 degrees Celsius. In the end, the outputs of these reactions yield up to millions of strands of DNA that can be examined to identify certain types of genes in diseases or utilized for scientific purposes.
Source: [1]
Steps to Run PCR
- Connect the PCR machine to the computer.
- Open the 'OpenPCR' program on the computer.
- Label the tubes. This information should include the patient number (1 or 2) or control (+ or -), as well as the replication number (1, 2, or 3).
- Prepare the experiment by inserting the reactants into the PCR tubes. These tubes will consist of the patients DNA, along with the other provided mixing components*. After filling each tube, put it into the chamber at the top of the machine.
- Close and tighten the lid of the chamber.
- Customize the settings in the 'Thermal Cycler' program to include three stages: Stage 1 - one cycle that will heat the reactants up to 95 degrees Celsius for three minutes, Stage 2 - 35 cycles that will heat the reactants to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds.
- Press start on the program to begin running the PCR.
- Collect and record data at the completion of the trial.
* Provided Mixing Components
a) TaqDNA polymerase (non-recombinant modified form)
b) MgCl2
c) dNTP's
d) reaction buffers (at optimal concentration for DNA template amplification)
| Reagent
| Volume
|
| Template DNA (20 ng)
| 0.2 μL
|
| 10 μM Forward Primer
| 1.0μL
|
| 10 μM Reverse Primer
| 1.0μL
|
| GoTaq master mix
| 50μL
|
| dH2O
| 47.8 μL
|
| Total Volume
| 100.0 μL
|
The Patient Information
| Patient Identification Number
| Gender
| Age
|
| 31542
| Male
| 55
|
| 52125
| Female
| 55
|
Flourimeter Measurements

Flourimeter Assembly Procedure
- Place a glass slide on the device.
- Using a pipette, add two drops of water to the slide.
- Turn on the blue LED light, and adjust the slide so that the light shines directly through the center of the water drop.
- Adjust the camera settings on a smartphone as follows:
- Turn off the flash
- Set exposure to the highest setting
- Set saturation to the highest setting
- Set contrast to the lowest setting
- Place the smartphone on the phone holder and position it in front the of fluorimeter device.
- Cover the entire setup with a black box in order to create as dark of an environment as possible.
- Take a picture with the smartphone. For best results, set the camera timer on the smartphone in order to be able to take a picture with the box completely closed.
How to Open Pictures Using Image J
- Using the smartphone, email the images to someone in the group with a computer.
- From the computer, open the email and download the images.
- Save the images to the computer.
- If the computer does not already have Image J installed, the program can be downloaded by going to http://rsb.info.nih.gov/ij/download.html
- In Image J, go to file, open, and then select the desired picture.
ImageJ Software Processing Measurements
| Sample
| Image or Background
| Area
| INTDEN
| RAWINTDEN
|
| Negative
| Sample 1
| 6724
| 20.639
| 138777
|
| Negative
| Background 1
| 6308
| 0.110
| 693
|
| Patient 2
| Sample 2
| 6943
| 31.042
| 215523
|
| Patient 2
| Background 2
| 6432
| 0.206
| 1326
|
| Patient 2
| Sample 3
| 4177
| 43.131
| 180160
|
| Patient 2
| Background 3
| 4177
| 0.009
| 39
|
| Patient 2
| Sample 4
| 8328
| 72.861
| 606790
|
| Patient 2
| Background 4
| 8328
| 0.022
| 180
|
| DNA Calf Thymus & Sybrgreen
| Sample 5
| 3745
| 15.377
| 57587
|
| DNA Calf Thymus & Sybrgreen
| Background 5
| 3725
| 0.029
| 107
|
| Positive
| Sample 6
| 6014
| 74.302
| 446850
|
| Positive
| Background 6
| 6014
| 0.017
| 103
|
| Patient 1
| Sample 7
| 4916
| 76.736
| 377325
|
| Patient 1
| Background 7
| 4916
| 0.023
| 112
|
| Patient 1
| Sample 8
| 4292
| 72.757
| 312275
|
| Patient 1
| Background 8
| 4594
| 0.158
| 728
|
| Patient 1
| Sample 9
| 7815
| 35.699
| 278990
|
| Patient 1
| Background 9
| 7815
| 0.015
| 114
|
| Water
| Sample 10
| 4844
| 51.982
| 251803
|
| Water
| Background 10
| 4784
| 0.010
| 47
|
|
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
After studying how the polymerase chain reaction machine works and the results it yields, we have to study how the DNA processed can be used to identify any sort of disease. Specifically, the rs17879961 cancer-associated sequence will produce a DNA signal because of the single nucleotide variation in its gene code. Based on our study of the rs17879961 cancer-associated sequence, we found that the missense mutation in e gene code yields a positive identification marker for cancer when the a single nucleotide C changes to a single nucleotide T.
Original Code:
GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC
Modified Code: (due to SNP)
GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC
When considering scientific detection of the missense mutation itself, we have found that our DNA sequence rs17879961 is related to the condition of Breast and Colorectal Cancer. Therefore, in the case of PCR detection, the sequence for rs17879961 would be copied for by a primer. The primer starts the copying going forward and backward, with the primer that correlate to the strand of DNA; this primer identify the cancer sequence out of the DNA. Then, the patient would have that strand of DNA extracted and prepared for PCR amplification process. This preparation would include the use of primers, taq Polymerase, solution and dNTPs, and other necessary materials. This solution would be inserted into the PCR machine to be heated/cooled/heated. Eventually, the PCR process would yield multiple strands of the DNA that was initially placed and the SNP part that we had identified. A non-cancer DNA sequence would not produce a signal because the nucleotide variation where a primer would replicate DNA would be out of place; therefore, its process of DNA amplification would occur as normal. Only when we have a mutation, can we identify a signal from the DNA (assuming that we are attempting to detect a normal nucleotide sequence).
As mentioned previously, we studied that the cancer marker, rs17879961, in the PCR experiment was correlated to the Breast and Colorectal cancer, but to completely understand the extent of this cancer's SNP to the development of cancer, we need to take a look at the statistics that not only follow Baye's Rule, but also provide useful information about the spread of this type of cancer. Based on conditional probabilities from a population diversity in Finland where the tested sample was 180 people, we found that the frequency of this cancer found in Finland was 7.8%. The genotype of this sequence of C/T in this population was 1.1% and the genotype of T/T was found to be 98.9%.
For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961.
BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.
Summary: This is an image of how RNA primers bind to the cancer DNA template during the replication process. [2]
Source:
[2]
Summary: This is an image of how Taq polymerases amplify the DNA. [3]
Source:
[3]
For more information on the PCR DNA replication process, please visit this website: http://learn.genetics.utah.edu/content/labs/pcr/.
Results
Positive Test
Negative Test

The Patient Information
| Patient Identification Number
| Gender
| Age
|
| 31542
| Male
| 55
|
| 52125
| Female
| 55
|
| Sample | Integrated Density | DNA μg/mL | Conclusion
|
| PCR: Negative Control | 138082.756 | 0.49 | NEG - Water
|
| PCR: Positive Control | 214199.614 | 1.54 | POS - Calf Thymus
|
| PCR: Patient 1 ID #####, rep 1 | 377121.108 | 2.70 | POS
|
| PCR: Patient 1 ID #####, rep 2 | 311547.192 | 2.23 | POS
|
| PCR: Patient 1 ID #####, rep 3 | 278870.460 | 1.00 | NEG
|
| PCR: Patient 2 ID #####, rep 1 | 253204.641 | 1.82 | POS
|
| PCR: Patient 2 ID #####, rep 2 | 180120.594 | 1.29 | NEG
|
| PCR: Patient 2 ID #####, rep 3 | 606603.192 | 4.35 | POS
|
KEY
- Sample = The sample is the substance tested using the flourimeter, in the case of this lab the substances used are a positive control, negative control, 3 trials for patient one, and 3 trials for patient 2.
- Integrated Density = Integrated density is the sum of the pixels in a given are, this is found by finding the product of the area and mean pixel value then subtracting the background.
- DNA μg/mL = This is the concentration of DNA in the respective sample, this is calculated by multiplying the integrated density by 2 and dividing by the integrated density value of calf thymus.
- Conclusion = A positive signal represents a sample that exhibited the same reaction to sybr green in the lab as our positive control; a negative signal represents a sample that exhibited the same reaction to sybr green as the negative control.