BME103:T930 Group 7 l2

From OpenWetWare

Revision as of 20:05, 28 November 2012 by Raphael Pascua (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Student: Elyse CandellRole(s: Machine Engineer)
Name: Student: Elyse Candell
Role(s: Machine Engineer)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Image:systemchange.png

The B/W part is a bluetooth/wifi sensor. This is to replace the computer.

The outside of the Thermal Cycler is now made out of Polyurethane Foam Rigid instead of wood.


Key Features
To make things easier, a smart phone will be able to control the the Thermal Cycler, like the computer did in our experiment. This is a button that will be pressed whenever a person wants to connect the Thermal Cycler either using their network or their bluetooth.

The Polyurethane Foam Rigid is a better material to help keep heat in when the Thermal Cycler is heating up and keep it cool when the Thermal Cycler is cooling down. This helps it to heat up faster and cool down faster, thus promoting faster cycles.

Instructions
1. Replace Wood panels with Polyurethane panels insulated with foam. 2. Attach B/W sensor to the side of the OpenPCR machine and press to activate the sensor. 3. Download the Open PCR Wireless App from the App Store onto your iPhone or smart phone. 4. Run the app on your phone and sync it with the Open PCR machine. 5. You are now ready to start using the machine. 6. Type in the temperatures, times and press start. 7. Run the process. 8. Analyze your data.




Protocols

Materials

Supplied in the Kit Amount
Test Tubes 32
Micropipette (10uL-100uL) 1
Disposable Pipette tips 100
PCR Reaction Mix 2 mL


Supplied by User Amount
Smartphone or Computer 1
Bluetooth Capability in Phone 1
USB Cord with Computer 1
Patient Samples 50 uL per Test Tube



PCR Protocol

Sample: The kit is provided with the PCR reaction mix that contains all the ingredients to amplify DNA, except for the DNA wanted to be replicated. The reaction mix will come in bulk of 2 mL and the user should place 50 uL of the PCR reaction mix into one of the provided test tubes. Subsequently 50 uL of the DNA sample, provided by the user, should be inserted into the test tube containing the reaction mix. This concludes the steps needed to create the sample ready for DNA amplification as this tube will be inserted into the OpenPCR Machine.

OpenPCR Machine: The OpenPCR Machine is provided in the kit and is already assembled for use and it just needs to be turned on. When turning it on there are two options for programming, and eventually receiving the results on, the machine. This can be accomplished by pushing the Bluetooth button on the machine or inserting a USB cord into the USB slot on the machine. If using Bluetooth, the Bluetooth on the user's phone also needs to be turned on and the programming options will open and can be set via smartphone; the same goes for a computer connected via USB cord. The machine must be programmed for five separate steps including the initial, the three various cycles, and the final. Each of these components have a box for inserting the degrees celsius required and the time slot allotted. The initial should be programmed at 95 degress celsius for 1 minute; the first of the cycles is 95 degrees celsius at 10 seconds, the second cycle is 57 degrees celsius at 10 seconds, and the third cycle is 72 degrees celsius at 10 seconds; the final should be 72 degrees celsius at 1 minute. These new, faster, and more efficient times and temperatures are courtesy of personal communication with Dr. Haynes. Once the programming is set, insert the testing tubes into the PCR machine and push start. Displayed on either the phone or computer should be an estimated time duration for how long it'll take to run the DNA amplification. When it's been completed the results will show up on either the smartphone or computer and the experiment will be completed!


DNA Measurement Protocol

Research and Development

Background on Disease Markers

SNP: rs74315509
CGC changed to CAC
This SNP is linked to schizophrenia. Schizophrenia is a mental disorder with numerous symptoms, including hallucinations, delusions, and abnormal social behavior. It is usually triggered by extreme anxiety in people who are genetically predisposed.
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509



Primer Design


forward primer: AGGGGGGCCAGGGCCTCAGTG
reverse primer: TGCCTTCCGC A CGAGCCCGTC
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.


Illustration

Image:BME103_Group-7_schiz_repl.jpg‎

Personal tools