The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
The B/W part is a bluetooth/wifi sensor. This is to replace the computer.
The outside of the Thermal Cycler is now made out of Polyurethane Foam Rigid instead of wood.
Key Features
To make things easier, a smart phone will be able to control the the Thermal Cycler, like the computer did in our experiment. This is a button that will be pressed whenever a person wants to connect the Thermal Cycler either using their network or their bluetooth.
The Polyurethane Foam Rigid is a better material to help keep heat in when the Thermal Cycler is heating up and keep it cool when the Thermal Cycler is cooling down. This helps it to heat up faster and cool down faster, thus promoting faster cycles.
forward primer: AGGGGGGCCAGGGCCTCAGTG
reverse primer: TGCCTTCCGC A CGAGCCCGTC
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.