BME103:T930 Group 7 l2: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 109: | Line 109: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
rs74315509 <br> | |||
This SNP is linked to schizophrenia. <br> | |||
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509 | |||
Line 117: | Line 120: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
forward primer: AGGGGGGCCAGGGCCTCAGTG <br> | |||
reverse primer: TGCCTTCCGC A CGAGCCCGTC <br> | |||
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially. | |||
Revision as of 12:25, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers rs74315509
|