BME103:T930 Group 7 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 115: Line 115:
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
SNP: rs74315509 <br>
SNP: rs74315509 <br>
 +
CGC changed to CAC <br>
This SNP is linked to schizophrenia. Schizophrenia is a mental disorder with numerous symptoms, including hallucinations, delusions, and abnormal social behavior. It is usually triggered by extreme anxiety in people who are genetically predisposed.
This SNP is linked to schizophrenia. Schizophrenia is a mental disorder with numerous symptoms, including hallucinations, delusions, and abnormal social behavior. It is usually triggered by extreme anxiety in people who are genetically predisposed.
<br>
<br>

Revision as of 18:22, 27 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Student: Elyse CandellRole(s: Machine Engineer)
Name: Student: Elyse Candell
Role(s: Machine Engineer)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Image:systemchange.png

The B/W part is a bluetooth/wifi sensor. This is to replace the computer.

The outside of the Thermal Cycler is now made out of Polyurethane Foam Rigid instead of wood.


Key Features
To make things easier, a smart phone will be able to control the the Thermal Cycler, like the computer did in our experiment. This is a button that will be pressed whenever a person wants to connect the Thermal Cycler either using their network or their bluetooth.

The Polyurethane Foam Rigid is a better material to help keep heat in when the Thermal Cycler is heating up and keep it cool when the Thermal Cycler is cooling down. This helps it to heat up faster and cool down faster, thus promoting faster cycles.

Instructions





Protocols

Materials

Supplied in the Kit Amount
Test Tubes 32
Micropipette (10uL-100uL) 1
Disposable Pipette tips 100
PCR Reaction Mix 2 mL


Supplied by User Amount
Smartphone or Computer 1
Bluetooth Capability in Phone 1
USB Cord with Computer 1
Patient Samples 50 uL per Test Tube



PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

SNP: rs74315509
CGC changed to CAC
This SNP is linked to schizophrenia. Schizophrenia is a mental disorder with numerous symptoms, including hallucinations, delusions, and abnormal social behavior. It is usually triggered by extreme anxiety in people who are genetically predisposed.
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509



Primer Design


forward primer: AGGGGGGCCAGGGCCTCAGTG
reverse primer: TGCCTTCCGC A CGAGCCCGTC
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.


Illustration

Image:BME103_Group-7_schiz_repl.jpg‎

Personal tools