BME103:T930 Group 7 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 128: Line 128:
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
-
 
+
[[Image:BME103_Group-7_schiz_repl.jpg‎]]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Revision as of 15:46, 15 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
Test Tubes 32
Micropipette (10uL-100uL) 1
Disposable Pipette tips 100
PCR Reaction Mix 2 mL


Supplied by User Amount
Smartphone or Computer 1
Bluetooth Capability in Phone 1
USB Cord with Computer 1
Patient Samples 50 uL per Test Tube



PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

rs74315509
This SNP is linked to schizophrenia.
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509



Primer Design


forward primer: AGGGGGGCCAGGGCCTCAGTG
reverse primer: TGCCTTCCGC A CGAGCCCGTC
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.


Illustration

Image:BME103_Group-7_schiz_repl.jpg‎

Personal tools