BME103:T930 Group 7 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
Line 109: Line 109:
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
rs74315509 <br>
This SNP is linked to schizophrenia. <br>
Line 117: Line 120:
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
forward primer: AGGGGGGCCAGGGCCTCAGTG <br>
reverse primer: TGCCTTCCGC A CGAGCCCGTC <br>
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.

Revision as of 14:25, 15 November 2012

BME 103 Fall 2012 Home
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Wiki Editing Help



Name: StudentRole(s)
Name: Student
Name: StudentRole(s)
Name: Student
Name: StudentRole(s)
Name: Student
Name: StudentRole(s)
Name: Student
Name: StudentRole(s)
Name: Student


Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.

System Design

Key Features




Supplied in the Kit Amount
Test Tubes 32
Micropipette (10uL-100uL) 1
Disposable Pipette tips 100
PCR Reaction Mix 2 mL

Supplied by User Amount
Smartphone or Computer 1
Bluetooth Capability in Phone 1
USB Cord with Computer 1
Patient Samples 50 uL per Test Tube

PCR Protocol

DNA Measurement Protocol

Research and Development

Background on Disease Markers

This SNP is linked to schizophrenia.

Primer Design

The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.


Personal tools