BME103:T930 Group 7 l2

From OpenWetWare

Revision as of 12:45, 18 November 2012 by Elyse M Candell (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Student: Elyse CandellRole(s: Machine Engineer)
Name: Student: Elyse Candell
Role(s: Machine Engineer)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
<systemchange.png>


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
Test Tubes 32
Micropipette (10uL-100uL) 1
Disposable Pipette tips 100
PCR Reaction Mix 2 mL


Supplied by User Amount
Smartphone or Computer 1
Bluetooth Capability in Phone 1
USB Cord with Computer 1
Patient Samples 50 uL per Test Tube



PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

rs74315509
This SNP is linked to schizophrenia.
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509



Primer Design


forward primer: AGGGGGGCCAGGGCCTCAGTG
reverse primer: TGCCTTCCGC A CGAGCCCGTC
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.


Illustration

Image:BME103_Group-7_schiz_repl.jpg‎

Personal tools