BME103:T930 Group 7

From OpenWetWare

Revision as of 21:46, 14 November 2012 by Wesley M. Karlin (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Wesley KarlinRole(s) Experimental Protocol Planner
Name: Wesley Karlin
Role(s) Experimental Protocol Planner
Name: Lauren EdwardsRole(s) Experimental Protocol Planner
Name: Lauren Edwards
Role(s) Experimental Protocol Planner
Name: Raphael PascuaRole(s) Machine Engineers
Name: Raphael Pascua
Role(s) Machine Engineers
Name: Elyse CandellRole(s) Machine Engineers
Name: Elyse Candell
Role(s) Machine Engineers
Name: Katey HemphillRole(s) Research and Design Scientist
Name: Katey Hemphill
Role(s) Research and Design Scientist

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design

Image:PCR Machine.png Description The OpenPCR Machine creates many copies of a small strand of DNA. In order to duplicate these DNA strands the PCR Machine must use many different temperatures during denaturing, annealing and extension. Denaturing is where the two strands of DNA separate. Annealing is where the DNA primer binds to the separate strands. Extension is when Taq Polymerase copies the DNA strands.


Experimenting With the Connections


When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked.

When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed.


Test Run

The date the machine was used was on Thursday October 24th, 2012. We had machine number 13. The team's experience with the device was as follows:


Pro's:

Lightweight

Silent

User Friendly

Great Software (it was very easy to use)


Con's:

Took too long to complete its task

Needed a computer

Hard open the lid

Not Aesthetically Pleasing

Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.)





Protocols

Polymerase Chain Reaction
PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA. The process includes the following steps:

1. Heat Denaturation: The heating of DNA to 95 degrees celsius allowed for the separation of the two strands of DNA. The nucleotides lose their base pair partners as the DNA is separated into a positive and a negative strand.

2. Annealing: The DNA now undergoes cooling of 57 degrees celsius to assist the process of annealing. Two primers are necessary for DNA replication as it's the primers that identify the specific targeted strand of DNA. Binding to the complementary sequence, the primers begin to produce the replication that's desired.

3. Extension: To finish off the first cycle of PCR, the temperature is once again raised to 72 degrees celsius. The enzyme Taq DNA polymerase then creates the new DNA strands by making each single strand now a double strand using the complementary sequences produced in annealing. The conclusion of these three steps is the production of two new DNA strands that are the replicate of the original strand.


PRC Master Mix Components:

- Bacterially derived Taq DNA polymerase

- dNTPs

- Magnesium Chloride

- Reaction buffers


Reagent Volume
Template DNA (20ng) 0.2 uL
10 uM forward primer 1.0 uL
10 uM reverse primer 1.0 uL
GoTaq master mix 50.0 uL
dH2O 47.8 uL
Total Volume 100 uL


The Samples There were eight samples that were ran PCR on during this experiment. This included a positive control cancer DNA template and a negative control without a DNA template.


Flourimeter Procedures

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA. The process includes the following:
1. Heat to 95 degrees C. This separates the complementary DNA strands
2. Cool to 57 degrees C. This allows the primers to bind to the DNA strand.
3. Heat to 72 degrees C. This allows Taq to extend the DNA copy
4. Repeat



A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially.

A SNP, or single nucleotide polymorphism, is a point mutation, meaning one nucleotide in a sequence is changed. This change is stable over many generations, and is present in at least 1% of the population. This makes the SNP ideal for a gene marker. The following sequence, rs17879961, was used as a primer for the cancerous gene
Cancer Sequence: AAACTCTTACACTGCATACA
Normal Sequence: AAACTCTTACATTGCATACA
the red C, specifically, makes the gene cancerous
The forward primer would be TTT because it matches AAA
The backward primer would be TGT because it matches ACA

Bayes' rule compares the odds of one event to another. We use it to predict the reliability of the PCR with detecting cancerous genes. In a study of 180 people, 1.1% were shown to have the mutation for cancer. Using Baye's rule, it was found that 7.8% of people should have cancer.
The formula for Baye's Rule is p (A|B) = [p(B|A) p(A)]/ p(B)
[[[Image:91m-1737.gif]]]
source: http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/pcr.html



Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 594480 0.303589886 Negative
PCR: Positive Control 4626020 2.362422427 Positive
PCR: Patient 1 ID 58515, rep 1 (Sample A) 816444 0.416942775 Negative
PCR: Patient 1 ID 58515, rep 2 (Sample B) 1268071 0.647580289 Negative
PCR: Patient 1 ID 58515, rep 3 (Sample C) 1126610 0.575338786 Negative
PCR: Patient 2 ID 19033, rep 1 (Sample D) 701057 0.358016779 Negative
PCR: Patient 2 ID 19033, rep 2 (Sample E) 275743 0.140816825 Negative
PCR: Patient 2 ID 19033, rep 3 (Sample F) 1030791 0.526405804 Negative


KEY

  • Sample = The DNA that we tested.
  • Integrated Density = Integrated density means the sum of all the pixels in the selected area. To get this value we used background subtraction. Background subtraction is when the background area value is subtracted from the sample (DNA) area value.
  • DNA μg/mL = To calculate this we used The DNA Calf Thymus Integrated Density and DNA ug/ml, and the integrated Density of another sample. We set it up as a fraction and solved for x. (DNA Calf Thymus Integrated density)/(DNA Calf Thymus DNA ug/ml) = (Integrated density of a sample)/x.
  • Conclusion= If the result was positive it meant that DNA was present and the PCR reaction was successful. If the result was negative it meant that DNA was not present and the PCR reaction was not successful. This is what the positive and negative controls were designed to do. The positive control was meant to be successful and the negative control was not.



Personal tools