OUR TEAM
Name: Wesley Karlin Role(s) Experimental Protocol Planner
| Name: Lauren Edwards Role(s) Experimental Protocol Planner
| Name: Raphael Pascua Role(s) Machine Engineers
| Name: Elyse Candell Role(s) Machine Engineers
| Name: Katey Hemphill Role(s) Research and Design Scientist
|
LAB 1 WRITE-UP
(Please finish by 11/7/2012)
Initial Machine Testing
The Original Design
(Add image of the full OpenPCR machine here, from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is)
Experimenting With the Connections
When we unplugged (part 3) from (part 6), the machine ... (did what? fill in your answer)
When we unplugged the white wire that connects (part 6) to (part 2), the machine ... (did what? fill in your answer)
Test Run
(Write the date you first tested Open PCR and your experience(s) with the machine)
Protocols
Polymerase Chain Reaction
The goal of Polymerase Chain Reaction is to amplify a DNA sequence. The way it works is the DNA undergoes several rounds of thermal cycling which involves the heating and cooling of the DNA.
(Add your work from Week 3, Part 1 here)
Flourimeter Measurements
(Add your work from Week 3, Part 2 here)
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
(Add a write-up of the information discussed in Week 3's class)
A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially.
The following sequence was used as a primer for the cancerous gene
AAACTCTTACACTGCATACA
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
(Your group will add the results of your Fluorimeter measurements from Week 4 here)
|