BME103:T930 Group 7

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Wesley Karlin Role(s) Experimental Protocol Planner Name: Lauren Edwards Role(s) Experimental Protocol Planner Name: Raphael Pascua Role(s) Machine Engineers Name: Elyse Candell Role(s) Machine Engineers Name: Katey Hemphill Role(s) Research and Design Scientist LAB 1 WRITE-UP (Please finish by 11/7/2012) Initial Machine Testing The Original Design (Add image of the full OpenPCR machine here, from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is) Description Experimenting With the Connections When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked. When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed. Test Run The date the machine was used was on Thursday October 24th, 2012 10:32:32. The team's experience with the device was as follows: Pro's Lightweight Silent User Friendly Great Software Con's Took too long to complete its task Needed a computer Hard open the lid Not Aesthetically Pleasing Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.) Protocols Polymerase Chain Reaction The goal of Polymerase Chain Reaction is to amplify a DNA sequence. The way it works is the DNA undergoes several rounds of thermal cycling which involves the heating and cooling of the DNA. (Add your work from Week 3, Part 1 here) Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially. The following sequence was used as a primer for the cancerous gene AAACTCTTACACTGCATACA the bolded C, specifically, makes the gene cancerous (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)