BME103:T930 Group 7

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Initial Machine Testing)
(Protocols)
Line 91: Line 91:
<br>
<br>
-
 
+
 +
PRC Master Mix Components:
 +
- Bacterially derived Taq DNA polymerase
 +
 
 +
- dNTPs
 +
 
 +
- Magnesium Chloride
 +
 
 +
- Reaction buffers
 +
 
 +
<br>
 +
 
 +
 
 +
 
(Add your work from Week 3, Part 1 here)<br>
(Add your work from Week 3, Part 1 here)<br>

Revision as of 13:59, 1 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Wesley KarlinRole(s) Experimental Protocol Planner
Name: Wesley Karlin
Role(s) Experimental Protocol Planner
Name: Lauren EdwardsRole(s) Experimental Protocol Planner
Name: Lauren Edwards
Role(s) Experimental Protocol Planner
Name: Raphael PascuaRole(s) Machine Engineers
Name: Raphael Pascua
Role(s) Machine Engineers
Name: Elyse CandellRole(s) Machine Engineers
Name: Elyse Candell
Role(s) Machine Engineers
Name: Katey HemphillRole(s) Research and Design Scientist
Name: Katey Hemphill
Role(s) Research and Design Scientist

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design

Image:PCR Machine.png Description The OpenPCR Machine creates many copies of a small strand of DNA. In order to duplicate these DNA strands the PCR Machine must use many different temperatures during annealing, denaturing and extension.


Experimenting With the Connections


When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked.

When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed.


Test Run

The date the machine was used was on Thursday October 24th, 2012 10:32:32. The team's experience with the device was as follows:


Pro's:

Lightweight

Silent

User Friendly

Great Software


Con's:

Took too long to complete its task

Needed a computer

Hard open the lid

Not Aesthetically Pleasing

Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.)





Protocols

Polymerase Chain Reaction
PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA. The process includes the following steps:

1. Heat Denaturation: The heating of DNA to 95 degrees celsius allowed for the separation of the two strands of DNA. The nucleotides lose their base pair partners as the DNA is separated into a positive and a negative strand.

2. Annealing: The DNA now undergoes cooling of 57 degrees celsius to assist the process of annealing. Two primers are necessary for DNA replication as it's the primers that identify the specific targeted strand of DNA. Binding to the complementary sequence, the primers begin to produce the replication that's desired.

3. Extension: To finish off the first cycle of PCR, the temperature is once again raised to 72 degrees celsius. The enzyme Taq DNA polymerase then creates the new DNA strands by making each single strand now a double strand using the complementary sequences produced in annealing. The conclusion of these three steps is the production of two new DNA strands that are the replicate of the original strand.


PRC Master Mix Components: - Bacterially derived Taq DNA polymerase

- dNTPs

- Magnesium Chloride

- Reaction buffers



(Add your work from Week 3, Part 1 here)


Flourimeter Measurements

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

(Add a write-up of the information discussed in Week 3's class)


A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially.

The following sequence was used as a primer for the cancerous gene
AAACTCTTACACTGCATACA
the bolded C, specifically, makes the gene cancerous
Bayes' rule campares the odds of one event to another. We use it to predict the reliability of the PCR.


(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)




Results

(Your group will add the results of your Fluorimeter measurements from Week 4 here)


Personal tools