BME103:T930 Group 7

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Initial Machine Testing)
Line 30: Line 30:
[[Image:PCR Machine.png]]
[[Image:PCR Machine.png]]
-
'''Experimenting With the Connections'''<br>
+
'''
 +
Description'''
-
When we unplugged (part 3) from (part 6), the machine ... (did what? fill in your answer)
 
-
When we unplugged the white wire that connects (part 6) to (part 2), the machine ... (did what? fill in your answer)
 
 +
'''Experimenting With the Connections'''<br>
 +
 +
When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked.
 +
 +
When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed.
'''Test Run'''
'''Test Run'''
-
(Write the date you first tested Open PCR and your experience(s) with the machine)<br>
+
The date the machine was used was on Thursday October 24th, 2012 10:32:32. The team's experience with the device was as follows:
 +
'''Pro's'''
 +
Lightweight
 +
Silent
 +
User Friendly
 +
Great Software
 +
 
 +
Con's
 +
Took too long to complete its task
 +
Needed a computer
 +
Hard open the lid
 +
Not Aesthetically Pleasing
 +
Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.)
 +
<br>

Revision as of 13:49, 1 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Wesley KarlinRole(s) Experimental Protocol Planner
Name: Wesley Karlin
Role(s) Experimental Protocol Planner
Name: Lauren EdwardsRole(s) Experimental Protocol Planner
Name: Lauren Edwards
Role(s) Experimental Protocol Planner
Name: Raphael PascuaRole(s) Machine Engineers
Name: Raphael Pascua
Role(s) Machine Engineers
Name: Elyse CandellRole(s) Machine Engineers
Name: Elyse Candell
Role(s) Machine Engineers
Name: Katey HemphillRole(s) Research and Design Scientist
Name: Katey Hemphill
Role(s) Research and Design Scientist

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design
(Add image of the full OpenPCR machine here, from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is)

Image:PCR Machine.png Description


Experimenting With the Connections

When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked.

When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed.

Test Run

The date the machine was used was on Thursday October 24th, 2012 10:32:32. The team's experience with the device was as follows: Pro's Lightweight Silent User Friendly Great Software

Con's Took too long to complete its task Needed a computer Hard open the lid Not Aesthetically Pleasing Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.)





Protocols

Polymerase Chain Reaction
The goal of Polymerase Chain Reaction is to amplify a DNA sequence. The way it works is the DNA undergoes several rounds of thermal cycling which involves the heating and cooling of the DNA. (Add your work from Week 3, Part 1 here)


Flourimeter Measurements

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

(Add a write-up of the information discussed in Week 3's class)


A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially.

The following sequence was used as a primer for the cancerous gene
AAACTCTTACACTGCATACA
the bolded C, specifically, makes the gene cancerous


(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)




Results

(Your group will add the results of your Fluorimeter measurements from Week 4 here)


Personal tools