BME103:T930 Group 6 l2 - Revision history

Nicholas Sterkowitz: /* Thermal Cycler Engineering */

2012-11-29T21:05:04Z

Thermal Cycler Engineering

←Older revision		Revision as of 21:05, 29 November 2012
Line 38:		Line 38:
	[[Image:Heating_Block_Picture.png\|300px\|thumb\|The heating block which will be re-sized]] </center> <br>		[[Image:Heating_Block_Picture.png\|300px\|thumb\|The heating block which will be re-sized]] </center> <br>

-	'''''Instructions'''''<br>	+	'''Instructions'''<br>
	<br>		<br>
	'''Handles''' <br>		'''Handles''' <br>

Nicholas Sterkowitz: /* Thermal Cycler Engineering */

2012-11-29T21:04:41Z

Thermal Cycler Engineering

←Older revision		Revision as of 21:04, 29 November 2012
Line 38:		Line 38:
	[[Image:Heating_Block_Picture.png\|300px\|thumb\|The heating block which will be re-sized]] </center> <br>		[[Image:Heating_Block_Picture.png\|300px\|thumb\|The heating block which will be re-sized]] </center> <br>

-	'''Instructions'''<br>	+	'''''Instructions'''''<br>
-	'Handles'	+	<br>
-	The new panels with handles will be needed to be placed on specific sides of the machine. They will be placed on the wider sides of the machine across from one another.	+	'''Handles''' <br>
-	'Bigger Heating Block'	+	The new panels with handles will be needed to be placed on specific sides of the machine. They will be placed on the wider sides of the machine across from one another. <br>
-	Because the heating block has a new row and column it will now be 5 by 5 having nine more places for test tubes. This will require a larger lid and a larger heating block to be used during assembly to accommodate for this new bigger size. Besides those changes the over all assembly will remain the same.	+	'''Bigger Heating Block''' <br>
-	'New Materials For Casing'	+	Because the heating block has a new row and column it will now be 5 by 5 having nine more places for test tubes. This will require a larger lid and a larger heating block to be used during assembly to accommodate for this new bigger size. Besides those changes the over all assembly will remain the same. <br>
		+	'''New Materials For Casing''' <br>
	The aluminum side panels will be assembled in the same way the wooden panels are. This change will not require new assembly instructions.		The aluminum side panels will be assembled in the same way the wooden panels are. This change will not require new assembly instructions.

Dominic Ilardi at 07:40, 29 November 2012

2012-11-29T07:40:31Z

←Older revision		Revision as of 07:40, 29 November 2012
Line 32:		Line 32:
	'''Key Features'''<br>		'''Key Features'''<br>

-	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, by eliminating the need for wood, the machine will be more eco-friendly. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. ~~This~~ will ~~however~~ require the addition of a new, larger heating lid.	+	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, by eliminating the need for wood, the machine will be more eco-friendly. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. However, the increased productivity of the additional row and column will require the addition of a new larger heating lid.
	We will also add two carrying handles to either side of the machine. This will aid in the transport and increase the machine's portability.		We will also add two carrying handles to either side of the machine. This will aid in the transport and increase the machine's portability.

Dominic Ilardi at 07:38, 29 November 2012

2012-11-29T07:38:14Z

←Older revision		Revision as of 07:38, 29 November 2012
Line 32:		Line 32:
	'''Key Features'''<br>		'''Key Features'''<br>

-	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, ~~changing to recycled aluminum will make~~ the machine more eco-friendly ~~because it eliminates the need for wood~~. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. This will however require the addition of a new, larger heating lid.	+	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, by eliminating the need for wood, the machine will be more eco-friendly. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. This will however require the addition of a new, larger heating lid.
	We will also add two carrying handles to either side of the machine. This will aid in the transport and increase the machine's portability.		We will also add two carrying handles to either side of the machine. This will aid in the transport and increase the machine's portability.

Dominic Ilardi at 07:37, 29 November 2012

2012-11-29T07:37:06Z

←Older revision		Revision as of 07:37, 29 November 2012
Line 33:		Line 33:

	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, changing to recycled aluminum will make the machine more eco-friendly because it eliminates the need for wood. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. This will however require the addition of a new, larger heating lid.		To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, changing to recycled aluminum will make the machine more eco-friendly because it eliminates the need for wood. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. This will however require the addition of a new, larger heating lid.
-	We will also add two carrying handles to either side of the machine. ~~Because~~ the ~~machine is somewhat awkward to carry~~ and ~~hold~~ the ~~handles will greatly reduce the chances of dropping if they are properly used~~.	+	We will also add two carrying handles to either side of the machine. This will aid in the transport and increase the machine's portability.

	<center>		<center>

Dominic Ilardi at 07:35, 29 November 2012

2012-11-29T07:35:48Z

←Older revision		Revision as of 07:35, 29 November 2012
Line 44:		Line 44:
	Because the heating block has a new row and column it will now be 5 by 5 having nine more places for test tubes. This will require a larger lid and a larger heating block to be used during assembly to accommodate for this new bigger size. Besides those changes the over all assembly will remain the same.		Because the heating block has a new row and column it will now be 5 by 5 having nine more places for test tubes. This will require a larger lid and a larger heating block to be used during assembly to accommodate for this new bigger size. Besides those changes the over all assembly will remain the same.
	'New Materials For Casing'		'New Materials For Casing'
-	The aluminum side panels will be assembled ~~through~~ the same way the wooden panels are. This change will not ~~need~~ new assembly instructions.	+	The aluminum side panels will be assembled in the same way the wooden panels are. This change will not require new assembly instructions.

	<!--- From Week 4 exercise --->		<!--- From Week 4 exercise --->

Dominic Ilardi at 07:33, 29 November 2012

2012-11-29T07:33:06Z

←Older revision		Revision as of 07:33, 29 November 2012
Line 32:		Line 32:
	'''Key Features'''<br>		'''Key Features'''<br>

-	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, changing to recycled aluminum will make the machine more eco-~~firndel~~ because it eliminates the need for wood. We will ~~also~~ add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine.	+	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, changing to recycled aluminum will make the machine more eco-friendly because it eliminates the need for wood. We will then add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine. This will however require the addition of a new, larger heating lid.
	We will also add two carrying handles to either side of the machine. Because the machine is somewhat awkward to carry and hold the handles will greatly reduce the chances of dropping if they are properly used.		We will also add two carrying handles to either side of the machine. Because the machine is somewhat awkward to carry and hold the handles will greatly reduce the chances of dropping if they are properly used.

Dominic Ilardi at 07:31, 29 November 2012

2012-11-29T07:31:40Z

←Older revision		Revision as of 07:31, 29 November 2012
Line 32:		Line 32:
	'''Key Features'''<br>		'''Key Features'''<br>

-	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. We will also add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine.	+	To begin with we will change the frame from a wooden construction to recycled aluminum. This will maintain the light-weight portability of the machine, but will greatly reduce the fire hazard of heating a wooden box to the required temperatures. Also, changing to recycled aluminum will make the machine more eco-firndel because it eliminates the need for wood. We will also add an additional row and column to the heating block to increase the product output without too much change to the overall size or cost of the machine.
	We will also add two carrying handles to either side of the machine. Because the machine is somewhat awkward to carry and hold the handles will greatly reduce the chances of dropping if they are properly used.		We will also add two carrying handles to either side of the machine. Because the machine is somewhat awkward to carry and hold the handles will greatly reduce the chances of dropping if they are properly used.

Taylor Deegan at 05:43, 29 November 2012

2012-11-29T05:43:25Z

←Older revision		Revision as of 05:43, 29 November 2012
Line 199:		Line 199:
	<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->		<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->

-	The SNP chosen for the lab is linked with Alzheimer's disease. Alzheimer's disease is the most common form of dementia. It has no cure and worsens as it progresses. Dementia is a loss of brain function and Alzheimer's disease affects memory, thinking, and behavior. The ~~associated~~ SNP~~'s for~~ an increase in risk of Alzheimer's disease is rs1050283, which is located on the 12 chromosome. ~~Information~~ available from the NCBI website:	+	The SNP chosen for the lab is linked with Alzheimer's disease. Alzheimer's disease is the most common form of dementia. It has no cure and worsens as it progresses. Dementia is a loss of brain function and Alzheimer's disease affects memory, thinking, and behavior. The chosen SNP that is associated with an increase in risk for Alzheimer's disease is rs1050283, which is located on the 12 chromosome. More information is available from the NCBI website:
	http://www.ncbi.nlm.nih.gov/snp?term=rs1050283		http://www.ncbi.nlm.nih.gov/snp?term=rs1050283

Line 207:		Line 207:
	<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->		<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->

-	The sequence that is connected with an increase risk of Alzheimer's disease is ~~GGCTGGGCOCGGACATGGAGGACGTG~~[C/T]~~GCGGCCGCCTGGTGCAGTACCGCGG~~. An increase in the risk for Alzheimer's disease comes from the base change C to a T.	+	The sequence that is connected with an increase risk of Alzheimer's disease is CTGGGCOCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCG. An increase in the risk for Alzheimer's disease comes from the base change of C to T.
	The reverse primer would be GGAGGACGTG[T]GCGGCCGCCT and the forward primer would be CCTCCTGCAG[A]CGCCGGCGGA.		The reverse primer would be GGAGGACGTG[T]GCGGCCGCCT and the forward primer would be CCTCCTGCAG[A]CGCCGGCGGA.
	A diseased allele will produce a PCR product because the gene associated with an increase risk that is trying to be tested for will have a T base in place of the normal C base. If the gene has this change in bases then the primers will be able to attach to the strands of DNA because the primers are designed to only attach to that specific sequence.		A diseased allele will produce a PCR product because the gene associated with an increase risk that is trying to be tested for will have a T base in place of the normal C base. If the gene has this change in bases then the primers will be able to attach to the strands of DNA because the primers are designed to only attach to that specific sequence.

Taylor Deegan at 23:54, 28 November 2012

2012-11-28T23:54:01Z

←Older revision		Revision as of 23:54, 28 November 2012
Line 222:		Line 222:
	[[Image:Prob-conditional-formula2.gif‎\|200px\|]]		[[Image:Prob-conditional-formula2.gif‎\|200px\|]]

-	~~Where~~ P(A\|B) is the probability that Alzheimer’s disease will occur given a positive PCR test result (a T present instead of a C in the SNP), P(B\|A) is the probability that a Alzheimer’s patient will test positive for the disease, P(A) is the probability of having the Alzheimer’s mutation, and P(B) is the probability of people without the Alzheimer’s disease mutation that yield positive results.	+	P(A\|B) is the probability that Alzheimer’s disease will occur given a positive PCR test result (a T present instead of a C in the SNP), P(B\|A) is the probability that a Alzheimer’s patient will test positive for the disease, P(A) is the probability of having the Alzheimer’s mutation, and P(B) is the probability of people without the Alzheimer’s disease mutation that yield positive results.

	<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
	\|}		\|}