BME103:T930 Group 4

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Alex Hoang Role(s): Open PCR Machine Engineer; DNA Measurement Operator Name: Bobby Ryan Role(s): Open PCR Machine Engineer; ImageJ Software Processor Name: Sabrina Freeman Role(s): Experimental Protocol Planner; Sample Preparation & Application Name: Sheanah Conneen Role(s): Experimental Protocol Planner; Data Compiler & Analyzer Name: Hayden Hilliard Role(s): Research and Development Scientist LAB 1 WRITE-UP Initial Machine Testing The Original Design https://myasucourses.asu.edu/courses/1/2012Fall-T-BME103-86053-86055-86054/groups/_185910_1//_7694078_1/Open%20PCR.png Experimenting With the Connections When we unplugged PCB Board of LCD from PCB of open PCR Circuit Board, the LCD display would turn off. When we unplugged the white wire that connects PCB of open PCR Cicuit Board to the temperature sensor wire, the temperature reading of the machine dropped drastically. Test Run 10/25/12 Testing the Open PCR for the first time was more complicated than we expected. Our Open PCR had technical difficulties that hindered its performance. Our samples took over 2 hours to cycle completely compared to other Open PCRs which took about 1 1/2 hours. In the end, the machine performed its task successfully. The software interface of the Open PCR was easy to understand and use. The LCD screen display also made it easy to monitor the progress of the test. Protocols Polymerase Chain Reaction Polymerase Chain Reaction (PCR) is a process used to amplify DNA by making millions of copies of a particular sequence. Prepare DNA samples and reagents in their respective containers. Create three copies of each original DNA sample. Be sure to label each container explicitly. Place samples in the PCR machine. Start the PCR machine. The samples will be heated to 95°C to unwind the helix. The temperature will drop to 57°C to activate the primer and strand pairing. The temperature will then rise to 72°C to activate the DNA polymerase for replication. Remove the sample from the PCR machine and store them until it is time to take flourimeter measurements. The PCR master mix is GoTaq® Colorless Master Mix, a premixed ready-to-use solution containing bacterially derived Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient amplification of DNA templates by PCR. Results Volume Template DNA (20 ng) 0.2 μL 10 μM forward primer 1.0 μL 10 μM reverse primer 1.0 μL GoTaq master mix 50.0 μL dH2O 47.8 μL Total Volume 100.0 μL Eight samples were ran. The first sample was a positive control for the gene being replicated. There were three samples from patient number 87998, a 48 year old female patient. There was also a negative control for the gene being replicated. There were three samples from patient number 21822, a 45 year old male patient. Flourimeter Protocol In order to prep for our measurements we took the following steps: We numbered our pipettes and our Eppendrof tubes so that we would only use it for one specific sample. We then transferred each sample into and Eppendorf tube containing 400 ml of buffer and labeled it with the number of the sample. Next we took the Eppendrof tube containing SYBR Green I and placed two drops on the first two centered drops. Then we took the diluted sample and placed two drops on top of the SYBR GREEN I solution drops. We aligned the light so that it was going through the drop. After setting the iPhone to the proper settings, we took pictures of each sample using the light box. In order to analyze our images, we loaded them on IMAGEJ. After making sure the settings were correct, we drew ovals around the green drop images and hit ANALYZE>MEASURE We recorded this data and continued on to get the background readings by drawing ovals of the same size as before in the green file to get the "noise". We then recorded these results. Research and Development Specific Cancer Marker Detection - The Underlying Technology When replicating DNA, one must make sure the primer is specific to a certain gene called checkpoint kinase 2. In this case, we studied the change in a base sequence located on Chromosome 22, which would result in the potential development of cancer. The location of the sequence change, known as rs17879961, was at 542, and again at 671. This alteration changes the codon ATT to ACT (thymine to cytosine), changing the coded protein from isoleucine to threonine. People who contain this missense mutation have the potential to develop breast or colorectal cancer, as well as Li-Fraumeni Syndrome. PCR reactions themselves follow a very simple process. First, they must be heated up to 95 degrees Celsius to unwind the DNA helix with heat. The temperature is then dropped to 57 degrees Celsius to activate the DNA primer and strand pairing. The final step involves turning the temperature back up, this time to 72 degrees Celsius to activate the DNA polymerase for replication. At the cellular level, there are many different "players" in the game of PCR reactions. The template DNA comes from the patient, and it is either positive or negative for a certain gene, in this case the cancer-linked gene. The primers initiate the reaction of replication by binding to specific areas of the DNA, while the enzyme Taq polymerase helps the primers by catalyzing the replication reaction. Also present in the reaction is Magnesium Chloride (MgCl2), which binds to Taq polymerase to encourage better work. Lastly, there are dNTP's involved in the reaction, or deoxynucleotide triphosphate. These are small pieces of nucleotides that are fused during replication. Only certain people will test positively for this test. This is because during the Polymerase Chain Reaction (PCR) detection, the primer will only recognize a certain sequence. So with the change from ATT to ACT, the primer will seek to recognize the said cancer-associated sequence. In this case, the sequence it must recognize is 3' ACATACGTCACATTCTCAAA 5'. The bold portion represents the changed protein codon, while the italicized letter represent the missense mutation, or change of a single nucleotide. So, if a patient has cancer, they will have this sequence described, and therefore, the PCR reaction will take place because the complement primer will bind to the site and replicate the DNA. However, if the patient does not have cancer, they will not have this changed base, nor the sequence for the primer to bind to. Therefore, no replication will occur. How Primers and Taq Polymerase Produce Replication Results Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control 639,218 1.654 negative PCR: Positive Control 405,796 1.107 positive PCR: Patient 1 ID 87998, rep 1 332,666 0.8606 positive PCR: Patient 1 ID 87998, rep 2 716,695 1.854 positive PCR: Patient 1 ID 87998, rep 3 868,481 2.247 positive PCR: Patient 2 ID 21822, rep 1 272,706 0.705 negative PCR: Patient 2 ID 21822, rep 2 99,377 0.257 negative PCR: Patient 2 ID 21822, rep 3 205,460 0.532 negative KEY Sample = Integrated Density = DNA μg/mL = Conclusion =