BME103:T930 Group 4
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
When we unplugged PCB Board of LCD from PCB of open PCR Circuit Board, the LCD display would turn off. When we unplugged the white wire that connects PCB of open PCR Cicuit Board to the temperature sensor wire, the temperature reading of the machine dropped drastically.
10/25/12 Testing the Open PCR for the first time was more complicated than we expected. Our Open PCR had technical difficulties that hindered its performance. Our samples took over 2 hours to cycle completely compared to other Open PCRs which took about 1 1/2 hours. In the end, the machine performed its task successfully. The software interface of the Open PCR was easy to understand and use. The LCD screen display also made it easy to monitor the progress of the test.
ProtocolsPolymerase Chain Reaction Polymerase Chain Reaction (PCR) is a process used to amplify DNA by making millions of copies of a particular sequence.
The PCR master mix is GoTaq® Colorless Master Mix, a premixed ready-to-use solution containing bacterially derived Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient amplification of DNA templates by PCR.
Eight samples were ran. The first sample was a positive control for the gene being replicated. There were three samples from patient number 87998, a 48 year old female patient. There was also a negative control for the gene being replicated. There were three samples from patient number 21822, a 45 year old male patient. Flourimeter Protocol In order to prep for our measurements we took the following steps:
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology When replicating DNA, one must make sure the primer is specific to a certain gene called checkpoint kinase 2. In this case, we studied the change in a base sequence located on Chromosome 22, which would result in the potential development of cancer. The location of the sequence change, known as rs17879961, was at 542, and again at 671. This alteration changes the codon ATT to ACT (thymine to cytosine), changing the coded protein from isoleucine to threonine. People who contain this missense mutation have the potential to develop breast or colorectal cancer, as well as Li-Fraumeni Syndrome. PCR reactions themselves follow a very simple process. First, they must be heated up to 95 degrees Celsius to unwind the DNA helix with heat. The temperature is then dropped to 57 degrees Celsius to activate the DNA primer and strand pairing. The final step involves turning the temperature back up, this time to 72 degrees Celsius to activate the DNA polymerase for replication. At the cellular level, there are many different "players" in the game of PCR reactions. The template DNA comes from the patient, and it is either positive or negative for a certain gene, in this case the cancer-linked gene. The primers initiate the reaction of replication by binding to specific areas of the DNA, while the enzyme Taq polymerase helps the primers by catalyzing the replication reaction. Also present in the reaction is Magnesium Chloride (MgCl2), which binds to Taq polymerase to encourage better work. Lastly, there are dNTP's involved in the reaction, or deoxynucleotide triphosphate. These are small pieces of nucleotides that are fused during replication. Only certain people will test positively for this test. This is because during the Polymerase Chain Reaction (PCR) detection, the primer will only recognize a certain sequence. So with the change from ATT to ACT, the primer will seek to recognize the said cancer-associated sequence. In this case, the sequence it must recognize is 3' ACATACGTCACATTCTCAAA 5'. The bold portion represents the changed protein codon, while the italicized letter represent the missense mutation, or change of a single nucleotide. So, if a patient has cancer, they will have this sequence described, and therefore, the PCR reaction will take place because the complement primer will bind to the site and replicate the DNA. However, if the patient does not have cancer, they will not have this changed base, nor the sequence for the primer to bind to. Therefore, no replication will occur.
Results
|