BME103:T930 Group 3 l2

From OpenWetWare

Revision as of 16:34, 28 November 2012 by Rohan Kumar (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Lekha Anantuni Role: R&D
Name: Lekha Anantuni
Role: R&D
Name: Rohan Kumar Role(s)
Name: Rohan Kumar
Role(s)
Name: Kyle Stoneking Role(s)
Name: Kyle Stoneking
Role(s)
Name: Austin Cuaderno Role(s)
Name: Austin Cuaderno
Role(s)
Name: Josh Eger Role(s)
Name: Josh Eger
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the kit Amount
Open PCR Machine 1
Template DNA (20 ng) 0.2 μL
Fluorimeter 1
Open PCR Software 1
Image J Software 1
Glass Slides 50

Supplied by User Amount
Pippets 8
Computer 1
10 μM reverse primer 1.0 μL
10 μM reverse primer 1.0 μL
GoTaq master mix 50.0 μL
dH2O 47.8 μL


PCR Protocol 1.) Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters. 2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples. 3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes. 4.)Then place the samples into the PCR machine 5.)Set the PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius


DNA Measurement Protocol

Research and Development

Background on Disease Markers

1.) The amyloid Beta precursor protein for Alzheimer's -
rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC

2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy -
rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG

Primer Design

1.) Forward primer: CTTC[G]ACCT
Reverse primer: TCCA[G]CTTC

2.) Forward primer: TGTT[A]CAGG
Reverse primer: GGAC[A]TTGT


Illustration

Exponential amplification of a specific gene.


Personal tools