BME103:T930 Group 3 l2

From OpenWetWare

Revision as of 01:01, 23 November 2012 by Lekha Anantuni (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Lekha Anantuni Role: R&D
Name: Lekha Anantuni
Role: R&D
Name: Rohan Kumar Role(s)
Name: Rohan Kumar
Role(s)
Name: Kyle Stoneking Role(s)
Name: Kyle Stoneking
Role(s)
Name: Austin Cuaderno Role(s)
Name: Austin Cuaderno
Role(s)
Name: Josh Eger Role(s)
Name: Josh Eger
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers

1.) The amyloid Beta precursor protein for Alzheimer's -
rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC

2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy -
rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG

Primer Design

1.) Forward primer: CTTC[G]ACCT
Reverse primer: TCCA[G]CTTC

2.) Forward primer: TGTT[A]CAGG
Reverse primer: GGAC[A]TTGT


Illustration

Exponential amplification of a specific gene.


Personal tools