BME103:T930 Group 3 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 89: Line 89:
rs80356547(http://omim.org/entry/314370#0002) <br>
rs80356547(http://omim.org/entry/314370#0002) <br>
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG <br><br>
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG <br><br>
-
 
-
 

Revision as of 17:43, 21 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers


1.) The amyloid Beta precursor protein for Alzheimer's - rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC

2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG


Primer Design



Illustration


Personal tools