BME103:T930 Group 3 l2
From OpenWetWare
(→Thermal Cycler Engineering) |
Current revision (16:56, 29 November 2012) (view source) (→Research and Development) |
||
| (28 intermediate revisions not shown.) | |||
| Line 14: | Line 14: | ||
|- valign="top" | |- valign="top" | ||
| [[Image:Peacock feather.jpg|100px|thumb|Name: Lekha Anantuni <br>Role: R&D]] | | [[Image:Peacock feather.jpg|100px|thumb|Name: Lekha Anantuni <br>Role: R&D]] | ||
| - | | [[Image: | + | | [[Image:Ted.jpg|100px|thumb|Name: Rohan Kumar <br>Experimental protocol planner]] |
| - | | [[Image: | + | | [[Image:Stewie.jpg|100px|thumb|Name: Kyle Stoneking <br>Experimental protocol planner]] |
| - | | [[Image: | + | | [[Image:7020-ukf-dubstep.png|100px|thumb|Name: Austin Cuaderno <br>Open PCR machine engineer]] |
| - | | [[Image: | + | | [[Image:Elmo.jpg|100px|thumb|Name: Josh Eger <br>Open PCR machine engineer]] |
|} | |} | ||
| Line 24: | Line 24: | ||
==Thermal Cycler Engineering== | ==Thermal Cycler Engineering== | ||
| - | + | <br> | |
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br> | Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br> | ||
| Line 30: | Line 30: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
| - | [[Image:BME103 Group3 PCR.jpg| | + | [[Image:BME103 Group3 PCR.jpg|300px|]]<br> |
| - | [[Image:BME103.Group3.Rechargeable Battery.PNG| | + | [[Image:BME103.Group3.Rechargeable Battery.PNG|400px|]] |
| - | [[Image:BME103.Group3.45454544543221.Wifi BlueTooth.PNG| | + | [[Image:BME103.Group3.45454544543221.Wifi BlueTooth.PNG|400px|]] |
| - | + | ||
| + | <br> | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
| + | The main features that we improved on this design of the Open PCR compared to the previous model was the portability and ease of use. The old Open PCR required a power cord that needed to be plugged into the wall at all times during use. The new design eliminates that inconvenience as it runs on a rechargable battery. It can be cumbersome to find a power outlet, but now the Open PCR can be used in more convenient places. | ||
| + | The old PCR also required a USB cable in order to send information to the computer and receive the input information on the program. The updated Open PCR is easier to connect to the computer since it does not need to be plugged in directly to the computer but instead connects via bluetooth. These two updates make the Open PCR portable and completely wireless. It is more convenient and easy to use compared to the old design of the PCR. | ||
| + | We additionally made our new design of the Open PCR aesthetically pleasing, so it will be available in bright and exciting colors such as red, green and purple. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
| + | 1) Plug in the PCR machine. <br> | ||
| + | 2) Turn on bluetooth on machine and phone. <br> | ||
| + | 3) Pair the devices to share the data collected. <br> | ||
| + | 4) Turn on wifi on the Computer. <br> | ||
| + | 5) Load the open PCR machine with samples to test. <br> | ||
| + | 6) Click "Run Test" on phone. <br> | ||
| + | 7) Wait for machine to finish running. <br> | ||
| + | 8) Test results with the Fluorometer. <br> | ||
| + | <!--- From Week 4 exercise ---> | ||
| - | + | <br> | |
| - | + | ||
| - | + | ||
| - | + | ||
==Protocols== | ==Protocols== | ||
| - | + | <br> | |
<!--- Design a new protocol based on your group's new PCR design. Make a step-by-step list of how someone should use your method | <!--- Design a new protocol based on your group's new PCR design. Make a step-by-step list of how someone should use your method | ||
Things to consider: | Things to consider: | ||
| Line 98: | Line 107: | ||
|- | |- | ||
| dH<sub>2</sub>O || 47.8 μL | | dH<sub>2</sub>O || 47.8 μL | ||
| + | |- | ||
| + | |Eppendrof tubes || 10 | ||
|- | |- | ||
|} | |} | ||
| Line 103: | Line 114: | ||
'''PCR Protocol'''<br> | '''PCR Protocol'''<br> | ||
| - | 1.) Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters.<br> | + | -Turn on PCR make sure it is fully charged, connect it to your computer using bluetooth or WiFi signal.<br> |
| + | 1.)Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters.<br> | ||
2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples.<br> | 2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples.<br> | ||
3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes.<br> | 3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes.<br> | ||
| Line 112: | Line 124: | ||
'''DNA Measurement Protocol'''<br> | '''DNA Measurement Protocol'''<br> | ||
| - | 1.) After your PCR has finished replication, take the samples to the fluorimeter. Using permanent marker number the transfer pipette at the bulb, so its only used for a single sample.<br> | + | 1.) After your PCR has finished replication, take the samples to the fluorimeter. Using permanent marker, number the transfer pipette at the bulb, so its only used for a single sample.<br> |
2.)With the permanent marker label the Eppendrof tubes at the top, you should have a total of 10 Eppendrof tubes labeled and 10 pipettes labeled.<br> | 2.)With the permanent marker label the Eppendrof tubes at the top, you should have a total of 10 Eppendrof tubes labeled and 10 pipettes labeled.<br> | ||
3.)Transfer each sample separately into the Eppendorf tubes containing 400 ml of buffer.<br> | 3.)Transfer each sample separately into the Eppendorf tubes containing 400 ml of buffer.<br> | ||
| Line 127: | Line 139: | ||
15.) Now move the previously drawn oval to an area away from the sample to obtain the noise measurements.<br> | 15.) Now move the previously drawn oval to an area away from the sample to obtain the noise measurements.<br> | ||
16.) Repeat this process for all of your samples, including the controls. <br> | 16.) Repeat this process for all of your samples, including the controls. <br> | ||
| + | <br> | ||
==Research and Development== | ==Research and Development== | ||
| Line 136: | Line 149: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
| - | 1.) The amyloid Beta precursor protein for Alzheimer's - <br> | + | 1.) The amyloid Beta precursor protein for Alzheimer's - Alzheimer's disease is a form of dementia in which patients experience loss of memory , confusion, as well as other symptoms. The amyloid hypothesis states that Alzheimer's is caused by a buildup of the amyloid protein in the brain. This gene for amyloid Beta precursor protein therefore might reveal to doctors and scientist whether or not an individual will develop Alzheimer's. <br> |
rs63751263 (http://omim.org/entry/104760#0008) <br> | rs63751263 (http://omim.org/entry/104760#0008) <br> | ||
AGACGGAGGAGATCTCTGAAGTGAAG ''[A/C]'' TGGATGCAGAATTCCGACATGACTC <br><br> | AGACGGAGGAGATCTCTGAAGTGAAG ''[A/C]'' TGGATGCAGAATTCCGACATGACTC <br><br> | ||
| - | 2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - <br> | + | 2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - Spinal muscular atrophy is a disease caused by a genetic mutation in the SMN1 gene. Individuals that have this disease exhibit various degrees of mobility impairment due to the widespread death of motor neurons. <br> |
rs80356547(http://omim.org/entry/314370#0002) <br> | rs80356547(http://omim.org/entry/314370#0002) <br> | ||
GATGGCGTGGCCAATGCCCTGGACAA ''[C/T]'' GTCCATGCCCGTCAGTTTGGAGGCG <br><br> | GATGGCGTGGCCAATGCCCTGGACAA ''[C/T]'' GTCCATGCCCGTCAGTTTGGAGGCG <br><br> | ||
| Line 158: | Line 171: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:DNA Amplification.jpg|200px|Exponential amplification of a specific gene.]]<br> | [[Image:DNA Amplification.jpg|200px|Exponential amplification of a specific gene.]]<br> | ||
| - | + | <br> | |
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler Engineering
Key Features The old PCR also required a USB cable in order to send information to the computer and receive the input information on the program. The updated Open PCR is easier to connect to the computer since it does not need to be plugged in directly to the computer but instead connects via bluetooth. These two updates make the Open PCR portable and completely wireless. It is more convenient and easy to use compared to the old design of the PCR. We additionally made our new design of the Open PCR aesthetically pleasing, so it will be available in bright and exciting colors such as red, green and purple. Instructions
Protocols
Materials
PCR Protocol
DNA Measurement Protocol Research and DevelopmentBackground on Disease Markers 1.) The amyloid Beta precursor protein for Alzheimer's - Alzheimer's disease is a form of dementia in which patients experience loss of memory , confusion, as well as other symptoms. The amyloid hypothesis states that Alzheimer's is caused by a buildup of the amyloid protein in the brain. This gene for amyloid Beta precursor protein therefore might reveal to doctors and scientist whether or not an individual will develop Alzheimer's. 2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - Spinal muscular atrophy is a disease caused by a genetic mutation in the SMN1 gene. Individuals that have this disease exhibit various degrees of mobility impairment due to the widespread death of motor neurons. Primer Design 1.) Forward primer: CTTC[G]ACCT
Illustration | |||||||||||||||||||||||||||||||||||||


