OUR TEAM
Name: Lekha Anantuni Role: R&D
| Name: Rohan Kumar Experimental protocol planner
| Name: Kyle Stoneking Experimental protocol planner
| Name: Austin Cuaderno Open PCR machine engineer
| Name: Josh Eger Open PCR machine engineer
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design

Key Features
The main features that we improved on this design of the Open PCR compared to the previous model was the portability and ease of using it. The old Open PCR required a power cord that needed to be plugged into the wall at all times during use. The new design eliminates that necessity as it has a rechargable battery so the Open PCR can be used anywhere. Sometimes it can be cumbersome to find a power outlet, but now the Open PCR can be put to use in convenient places. The old PCR also required a USB cable in order to send information to the computer and receive the input information on the program. The updated Open PCR is easier to connect to the computer since it does not need to be plugged in directly to the computer but instead connects via bluetooth. These two updates make the Open PCR portable and completely wireless. It is more convenient and easy to use compared to the old design of the PCR.
Instructions
1) Plug in the PCR machine.
Protocols
Materials
| Supplied in the kit | Amount
|
| Open PCR Machine | 1
|
| Template DNA (20 ng) | 0.2 μL
|
| Fluorimeter | 1
|
| Open PCR Software | 1
|
| Image J Software | 1
|
| Glass Slides | 50
|
| Supplied by User | Amount
|
| Pippets | 8
|
| Computer | 1
|
| 10 μM reverse primer | 1.0 μL
|
| 10 μM reverse primer | 1.0 μL
|
| GoTaq master mix | 50.0 μL
|
| dH2O | 47.8 μL
|
| Eppendrof tubes | 10
|
PCR Protocol
-Turn on PCR make sure it is fully charged, connect it to your computer using bluetooth or WiFi signal.
1.)Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters.
2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples.
3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes.
4.)Then place the samples into the PCR machine.
5.)Set the PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius.
DNA Measurement Protocol
1.) After your PCR has finished replication, take the samples to the fluorimeter. Using permanent marker number the transfer pipette at the bulb, so its only used for a single sample.
2.)With the permanent marker label the Eppendrof tubes at the top, you should have a total of 10 Eppendrof tubes labeled and 10 pipettes labeled.
3.)Transfer each sample separately into the Eppendorf tubes containing 400 ml of buffer.
4.)Using a specially labeled Eppendorf tube containing SYBR GREEN, with its own pippter, place two drops onto the first two center drops.
5.)Then using the sample place two drops on top of the SYBR GREEN solution drops.
6.)Then align the blue light of the fluorimeter so it passes through the drop.
7.)Then the smartphone operator should take a picture with the settings on the phone adjusted to inactive flash, iso to 800, white balance to auto, exposure to the highest setting and contrast to the lowest setting.
8.)This process should be repeated for all samples.
9.)Now analyze your pictures with Image J software.
10.)Open the software. Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value. 11.)Using the menu select image > color > split channels.
12.) This should have created 3 files: a red, green and blue image. You only need the green image.
13.) Now click the menu bar to activate the oval selection.
14.) Draw an oval around the image of your sample and then select analyze > measure.
15.) Now move the previously drawn oval to an area away from the sample to obtain the noise measurements.
16.) Repeat this process for all of your samples, including the controls.
Research and Development
Background on Disease Markers
1.) The amyloid Beta precursor protein for Alzheimer's -
rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC
2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy -
rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG
Primer Design
1.) Forward primer: CTTC[G]ACCT
Reverse primer: TCCA[G]CTTC
2.) Forward primer: TGTT[A]CAGG
Reverse primer: GGAC[A]TTGT
Illustration

|