BME103:T930 Group 3 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(OUR TEAM)
(Research and Development)
Line 100: Line 100:
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
 +
 +
[[Image:DNA Amplification.jpg|200px|Exponential amplification of a specific gene.]]<br>
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Revision as of 00:20, 23 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Lekha Anantuni Role: R&D
Name: Lekha Anantuni
Role: R&D
Name: Rohan Kumar Role(s)
Name: Rohan Kumar
Role(s)
Name: Kyle Stoneking Role(s)
Name: Kyle Stoneking
Role(s)
Name: Austin Cuaderno Role(s)
Name: Austin Cuaderno
Role(s)
Name: Josh Eger Role(s)
Name: Josh Eger
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers


1.) The amyloid Beta precursor protein for Alzheimer's -
rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC

2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy -
rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG

Primer Design



Illustration


Exponential amplification of a specific gene.


Personal tools