BME103:T930 Group 3 - Revision history

Lekha Anantuni: /* Research and Development */

2012-11-15T18:26:03Z

Research and Development

←Older revision		Revision as of 18:26, 15 November 2012
Line 175:		Line 175:
	Our research of the DNA sequence rs17879961 reveals that the gene sequence is correlated most directly to Breast and Colorectal Cancer. The ''Protocol'' section explains how the Open PCR amplifies this specific DNA sequence. A non-cancer DNA sequence would not produce a signal because the primer would not bind to the DNA and therefore would not allow for any replication. Only when we have the specific missense mutation can we replicate the cancer gene and identify a positive signal from the DNA.<br><br>		Our research of the DNA sequence rs17879961 reveals that the gene sequence is correlated most directly to Breast and Colorectal Cancer. The ''Protocol'' section explains how the Open PCR amplifies this specific DNA sequence. A non-cancer DNA sequence would not produce a signal because the primer would not bind to the DNA and therefore would not allow for any replication. Only when we have the specific missense mutation can we replicate the cancer gene and identify a positive signal from the DNA.<br><br>

-	Although we determined that the DNA sequence rs17879961 was correlated to the Breast and Colorectal cancer, we must look at Baye's rule and other statistics to understand the likelihood that the gene will in fact lead to the development and spread of the cancer. Bayesian reasoning accounts for the prevalence, sensitivity, specificity and false positive rates of a disease in order to further understand that disease. Sensitivity is the likelihood that a person afflicted with the disease will test positive for it, while specificity is the likelihood that a person without the disease will test negative for it. ~~Based on conditional~~ probabilities of a sample of 180 people ~~from a population diversity~~ in Finland~~, it was~~ determined that the frequency of this cancer found in Finland was 7.8%. The genotype of this ~~sequence of C/T~~ in this population was 1.1% and the genotype ~~of T/T~~ was found to be 98.9%.<br>	+	Although we determined that the DNA sequence rs17879961 was correlated to the Breast and Colorectal cancer, we must look at Baye's rule and other statistics to understand the likelihood that the gene will in fact lead to the development and spread of the cancer. Bayesian reasoning accounts for the prevalence, sensitivity, specificity and false positive rates of a disease in order to further understand that disease. Sensitivity is the likelihood that a person afflicted with the disease will test positive for it, while specificity is the likelihood that a person without the disease will test negative for it. Conditional probabilities of a sample of 180 people in Finland determined that the frequency of this cancer found in Finland was 7.8%. The genotype of this single nucleotide polymorphism change from cytosine to thymine in this population was 1.1% and the genotype without the SNP was found to be 98.9%.<br>

	For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961.<br><br>		For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961.<br><br>

Lekha Anantuni: /* Research and Development */

2012-11-15T18:21:31Z

Research and Development

←Older revision		Revision as of 18:21, 15 November 2012
Line 170:		Line 170:
	GGAAGTGGGTCCTAAAAACTCTTACA['''''C''''']TGCATACATAGAAGATCACAGTGGC<br><br>		GGAAGTGGGTCCTAAAAACTCTTACA['''''C''''']TGCATACATAGAAGATCACAGTGGC<br><br>

-	''Code with SNP''<br>	+	''Code with SNP:''<br>
	GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br>		GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br>

Lekha Anantuni: /* Research and Development */

2012-11-15T18:21:10Z

Research and Development

←Older revision		Revision as of 18:21, 15 November 2012
Line 170:		Line 170:
	GGAAGTGGGTCCTAAAAACTCTTACA['''''C''''']TGCATACATAGAAGATCACAGTGGC<br><br>		GGAAGTGGGTCCTAAAAACTCTTACA['''''C''''']TGCATACATAGAAGATCACAGTGGC<br><br>

-	''~~Mutated~~ Code~~: (due to~~ SNP ~~(or mutation))~~''<br>	+	''Code with SNP''<br>
	GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br>		GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br>

Kyle T. Stoneking: /* OUR TEAM */

2012-11-15T16:44:13Z

OUR TEAM

←Older revision		Revision as of 16:44, 15 November 2012
Line 14:		Line 14:
	\|- valign="top"		\|- valign="top"
	\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]		\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]
-	\| [[Image:~~20121006 150506~~.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]	+	\| [[Image:Stewie.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]
	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]		\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]

Kyle T. Stoneking: /* OUR TEAM */

2012-11-15T16:40:11Z

OUR TEAM

←Older revision		Revision as of 16:40, 15 November 2012
Line 14:		Line 14:
	\|- valign="top"		\|- valign="top"
	\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]		\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]
-	\| [[Image:~~BME103student~~.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]	+	\| [[Image:20121006 150506.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]
	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]		\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]

Austin Reid Cuadero: /* Research and Development */

2012-11-15T16:39:51Z

Research and Development

←Older revision		Revision as of 16:39, 15 November 2012
Line 187:		Line 187:


-	~~<br>~~<br>	+	<br>

	==Results==		==Results==

Austin Reid Cuadero: /* OUR TEAM */

2012-11-15T16:29:57Z

OUR TEAM

←Older revision		Revision as of 16:29, 15 November 2012
Line 17:		Line 17:
	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]		\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]
-	\| [[Image:~~Bigbird~~.~~jpg~~\|125px\|thumb\| Austin Cuaderno<br>Machine Engineer]]	+	\| [[Image:7020-ukf-dubstep.png\|125px\|thumb\| Austin Cuaderno<br>Machine Engineer]]
	\|}		\|}

Lekha Anantuni: /* OUR TEAM */

2012-11-15T11:12:42Z

OUR TEAM

←Older revision		Revision as of 11:12, 15 November 2012
Line 15:		Line 15:
	\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]		\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]
	\| [[Image:BME103student.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]		\| [[Image:BME103student.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]
-	\| [[Image:~~Ernie2~~.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]	+	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]
	\| [[Image:Bigbird.jpg\|125px\|thumb\| Austin Cuaderno<br>Machine Engineer]]		\| [[Image:Bigbird.jpg\|125px\|thumb\| Austin Cuaderno<br>Machine Engineer]]

Lekha Anantuni: /* Initial Machine Testing */

2012-11-15T11:08:26Z

Initial Machine Testing

←Older revision		Revision as of 11:08, 15 November 2012
Line 35:		Line 35:
	'''Experimenting With the Connections'''<br>		'''Experimenting With the Connections'''<br>

-	When we unplugged the ~~lcd~~ display wire(part 3) from the Arudnio chip(part 6), the screen turned off. Everything on the PCR was working fine expect there was no output on the display. When we unplugged the white wire that connects Arudino chip(part 6) to thermal cycler (part 2), the reading from the screen dropped to -40 degrees Celsius. We disconnected the wire multiple times and each time the screen displayed -40 degrees Celsius.	+	When we unplugged the LCD display wire(part 3) from the Arudnio chip(part 6), the screen turned off. Everything on the PCR was working fine expect there was no output on the display. When we unplugged the white wire that connects Arudino chip(part 6) to thermal cycler (part 2), the reading from the screen dropped to -40 degrees Celsius. We disconnected the wire multiple times and each time the screen displayed -40 degrees Celsius.

Lekha Anantuni: /* Protocols */

2012-11-15T11:07:36Z

Protocols

←Older revision		Revision as of 11:07, 15 November 2012
Line 141:		Line 141:

	'''Image J Procedure:'''<br>		'''Image J Procedure:'''<br>
-	1.)Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value	+	1.) Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value

-	2.)Using the menu selection we used, image > color > split channels	+	2.) Using the menu selection we used, image > color > split channels

-	3.) This created 3 files	+	3.) This created 3 files: a red, green and blue image. We only used the green image.

-	4.)~~The~~ we clicked menu bar to activate the oval selection.	+	4.) Then we clicked the menu bar to activate the oval selection.

-	5.)We drew an oval around ~~our green drop~~ image and then selected analyze > measure.	+	5.) We drew an oval around the image of our sample and then selected analyze > measure.

-	6.) We then ~~repeated~~ the oval ~~process but for the~~ area ~~above~~ the ~~drop,~~ to ~~get~~ the noise ~~measurement~~.	+	6.) We then simply moved the previously drawn oval to an area away from the sample to obtain the noise measurements.
		+
		+	7.) We repeated this process for all of the samples, including the controls.

←Older revision		Revision as of 16:44, 15 November 2012
Line 14:		Line 14:
	\|- valign="top"		\|- valign="top"
	\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]		\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]
-	\| [[Image:~~20121006 150506~~.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]	+	\| [[Image:Stewie.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]
	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]		\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]

←Older revision		Revision as of 16:40, 15 November 2012
Line 14:		Line 14:
	\|- valign="top"		\|- valign="top"
	\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]		\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]
-	\| [[Image:~~BME103student~~.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]	+	\| [[Image:20121006 150506.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]
	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]		\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]

←Older revision		Revision as of 11:12, 15 November 2012
Line 15:		Line 15:
	\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]		\| [[Image:Ted.jpg\|125px\|thumb\| Rohan Kumar<br> Experimental Protocol Planner]]
	\| [[Image:BME103student.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]		\| [[Image:BME103student.jpg\|125px\|thumb\| Kyle Stoneking<br>Experimental Protocol Planner]]
-	\| [[Image:~~Ernie2~~.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]	+	\| [[Image:Madagascar lemur.jpg\|125px\|thumb\| Lekha Anantuni<br>R&D Scientist ]]
	\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]		\| [[Image:Elmo.jpg\|125px\|thumb\| Joshua Eger<br>Machine Engineer]]
	\| [[Image:Bigbird.jpg\|125px\|thumb\| Austin Cuaderno<br>Machine Engineer]]		\| [[Image:Bigbird.jpg\|125px\|thumb\| Austin Cuaderno<br>Machine Engineer]]