BME103:T930 Group 3
From OpenWetWare
(→Research and Development) |
Current revision (14:26, 15 November 2012) (view source) (→Research and Development) |
||
| (40 intermediate revisions not shown.) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| - | | [[Image: | + | | [[Image:Ted.jpg|125px|thumb| Rohan Kumar<br> Experimental Protocol Planner]] |
| - | | [[Image: | + | | [[Image:Stewie.jpg|125px|thumb| Kyle Stoneking<br>Experimental Protocol Planner]] |
| - | | [[Image: | + | | [[Image:Madagascar lemur.jpg|125px|thumb| Lekha Anantuni<br>R&D Scientist ]] |
| - | | [[Image: | + | | [[Image:Elmo.jpg|125px|thumb| Joshua Eger<br>Machine Engineer]] |
| - | | [[Image: | + | | [[Image:7020-ukf-dubstep.png|125px|thumb| Austin Cuaderno<br>Machine Engineer]] |
|} | |} | ||
| Line 35: | Line 35: | ||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
| - | When we unplugged the | + | When we unplugged the LCD display wire(part 3) from the Arudnio chip(part 6), the screen turned off. Everything on the PCR was working fine expect there was no output on the display. When we unplugged the white wire that connects Arudino chip(part 6) to thermal cycler (part 2), the reading from the screen dropped to -40 degrees Celsius. We disconnected the wire multiple times and each time the screen displayed -40 degrees Celsius. |
| Line 65: | Line 65: | ||
5.)We set our PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius.<br> | 5.)We set our PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius.<br> | ||
| + | <br> | ||
| + | '''The Patient Information'''<br> | ||
| + | {|border="1" cellpadding="5" | ||
| + | |- | ||
| + | ! scope="col" | Patient Identification Number | ||
| + | ! scope="col" | Gender | ||
| + | ! scope="col" | Age | ||
| + | |- | ||
| + | |43891 | ||
| + | |Male | ||
| + | |48 | ||
| + | |- | ||
| + | |36890 | ||
| + | |Female | ||
| + | |56 | ||
| + | |} | ||
| - | |||
| - | |||
| - | |||
'''GO Taq DNA Mix''' | '''GO Taq DNA Mix''' | ||
| Line 94: | Line 107: | ||
[[Image:BME-03 box.jpg|200px|The exterior of the fluorimeter]] | [[Image:BME-03 box.jpg|200px|The exterior of the fluorimeter]] | ||
[[Image:BME003 Part1.jpg|200px|The interior. Samsung camera facing the slide]] | [[Image:BME003 Part1.jpg|200px|The interior. Samsung camera facing the slide]] | ||
| - | [[Image:BME003Part3.jpg|200px|The interior. close up camera]]<br> | + | [[Image:BME003Part3.jpg|200px|The interior. close up camera]] |
| + | [[Image:BME003 Waterdrop.jpg|200px|waterdrop]]<br> | ||
1.) The first picture is the extertor of the fuorimeter.<br> | 1.) The first picture is the extertor of the fuorimeter.<br> | ||
2.) The second picture shows the interior. The smartphone camera is angled to have a view of the slide. During actual use the slide platform was sightly elevated with plates for a better view of the drop.<br> | 2.) The second picture shows the interior. The smartphone camera is angled to have a view of the slide. During actual use the slide platform was sightly elevated with plates for a better view of the drop.<br> | ||
| - | 3.) The third picture shows the slide in view of the camera. During actual use the settings were changed and the lid was closed for optimal accuracy. <br> | + | 3.) The third picture shows the slide in view of the camera. During actual use the settings were changed and the lid was closed for optimal accuracy. <br> |
| + | 4.) The fourth picture is an areial view of the what the slide setup looks like. The water drop is nested in place. | ||
'''Fluorimeter Procedure:'''<br> | '''Fluorimeter Procedure:'''<br> | ||
| Line 117: | Line 132: | ||
9.)After picture was taken it was given to the Image J software | 9.)After picture was taken it was given to the Image J software | ||
| + | |||
| + | [[Image:Positive Control.jpg|200px|The image of the positive control before analysis]] | ||
| + | [[Image:Negative Control.jpg|200px|The image of the negative control before analysis]] | ||
| + | |||
| + | |||
| + | 1.) The first image is the positive control sample before ImageJ analysis.<br> | ||
| + | 2.) The second image is the negative control sample before ImageJ analysis.<br> | ||
'''Image J Procedure:'''<br> | '''Image J Procedure:'''<br> | ||
| - | 1.)Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value | + | 1.) Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value |
| - | 2.)Using the menu selection we used, image > color > split channels | + | 2.) Using the menu selection we used, image > color > split channels |
| - | 3.) This created 3 files | + | 3.) This created 3 files: a red, green and blue image. We only used the green image. |
| - | 4.) | + | 4.) Then we clicked the menu bar to activate the oval selection. |
| - | 5.)We drew an oval around | + | 5.) We drew an oval around the image of our sample and then selected analyze > measure. |
| - | 6.) We then | + | 6.) We then simply moved the previously drawn oval to an area away from the sample to obtain the noise measurements. |
| + | |||
| + | 7.) We repeated this process for all of the samples, including the controls. | ||
| Line 139: | Line 163: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
| - | + | In order to isolate and detect the cancer-causing gene, we essentially added a very specific primer that attaches to the cancer gene on the DNA. This Primer will not only allow for replication of the DNA, but more specifically, replication of the cancer gene in the DNA sample. The Open PCR machine then manipulates the temperature of the sample to facilitate the constant replication of the isolated DNA strands. We cycled the machine 30 times (the DNA was replicated 30 times) to be sure we had enough of the cancer DNA present in our solution. <br><br> | |
| + | By understanding the mechanism of the Open PCR, we can intuitively understand how genes with specific diseases - such as cancer - are amplified. It is now necessary to learn how to identify which samples contain those replicated genes. The rs17879961 cancer-associated sequence in particular, can be identified within the DNA because of the single nucleotide variation - in this case a missense mutation - in its gene code. The mutation will yield a positive identification marker for cancer when the nucleotide cytosine is replaced by thymine in a very specific section of the DNA. <br><br> | ||
| + | ''Original Code:''<br> | ||
| + | GGAAGTGGGTCCTAAAAACTCTTACA['''''C''''']TGCATACATAGAAGATCACAGTGGC<br><br> | ||
| - | <br><br> | + | ''Code with SNP:''<br> |
| + | GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br> | ||
| + | |||
| + | Our research of the DNA sequence rs17879961 reveals that the gene sequence is correlated most directly to Breast and Colorectal Cancer. The ''Protocol'' section explains how the Open PCR amplifies this specific DNA sequence. A non-cancer DNA sequence would not produce a signal because the primer would not bind to the DNA and therefore would not allow for any replication. Only when we have the specific missense mutation can we replicate the cancer gene and identify a positive signal from the DNA.<br><br> | ||
| + | |||
| + | Although we determined that the DNA sequence rs17879961 was correlated to the Breast and Colorectal cancer, we must look at Baye's rule and other statistics to understand the likelihood that the gene will in fact lead to the development and spread of the cancer. Bayesian reasoning accounts for the prevalence, sensitivity, specificity and false positive rates of a disease in order to further understand that disease. Sensitivity is the likelihood that a person afflicted with the disease will test positive for it, while specificity is the likelihood that a person without the disease will test negative for it. Conditional probabilities of a sample of 180 people in Finland determined that the frequency of this cancer found in Finland was 7.8%. The genotype of this single nucleotide polymorphism change from cytosine to thymine in this population was 1.1% and the genotype without the SNP was found to be 98.9%.<br> | ||
| + | |||
| + | For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961.<br><br> | ||
| + | |||
| + | '''''BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.'''''<br><br> | ||
| + | |||
| + | [[Image:PCR steps.jpg|200px|The mechanism of the Open PCR machine.]] | ||
| + | [[Image:DNA Amplification.jpg|200px|Exponential amplification of a specific gene.]]<br> | ||
| + | |||
| + | 1.) Both of the above images: http://users.ugent.be/~avierstr/principles/pcr.html <br> | ||
| + | |||
| + | |||
| + | <br> | ||
==Results== | ==Results== | ||
| Line 155: | Line 199: | ||
| '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | | '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | ||
|- | |- | ||
| - | | PCR: Negative Control || 4528827 || 1.08 || Positive | + | | '''PCR: Negative Control''' || 4528827 || 1.08 || Positive |
|- | |- | ||
| - | | PCR: Positive Control || 8351858 || 2 || Positive | + | | '''PCR: Positive Control (Calf Thymus)''' || 8351858 || 2 || Positive |
|- | |- | ||
| - | | PCR: Patient 1 ID 43891, rep 1 || 5283304 || 1.26 || Positive | + | | '''PCR: Patient 1 ID 43891, rep 1''' || 5283304 || 1.26 || Positive |
|- | |- | ||
| - | | PCR: Patient 1 ID 43891, rep 2 || 4376083 || 1.05 || Positive(borderline) | + | | '''PCR: Patient 1 ID 43891, rep 2''' || 4376083 || 1.05 || Positive(borderline) |
|- | |- | ||
| - | | PCR: Patient 1 ID 43891, rep 3 || 8144751 || 1.95 || Positive | + | | '''PCR: Patient 1 ID 43891, rep 3''' || 8144751 || 1.95 || Positive |
|- | |- | ||
| - | | PCR: Patient 2 ID 36890, rep 1 || 4190775 || 1 || Negative(borderline) | + | | '''PCR: Patient 2 ID 36890, rep 1''' || 4190775 || 1 || Negative(borderline) |
|- | |- | ||
| - | | PCR: Patient 2 ID 36890, rep 2 || 5721560 || 1.37 || Positive | + | | '''PCR: Patient 2 ID 36890, rep 2''' || 5721560 || 1.37 || Positive |
|- | |- | ||
| - | | PCR: Patient 2 ID 36890, rep 3 || 5611447 || 1.34 || Positive | + | | '''PCR: Patient 2 ID 36890, rep 3''' || 5611447 || 1.34 || Positive |
|} | |} | ||
| Line 176: | Line 220: | ||
* '''Sample''' = Sample is the DNA sample we are analyzing | * '''Sample''' = Sample is the DNA sample we are analyzing | ||
* '''Integrated Density''' = The integrated density is similar to a numerical representation of the measure light in a given area. The integrated density in the above table is found by taking the integrated density of the sample and subtracting the background noise from that | * '''Integrated Density''' = The integrated density is similar to a numerical representation of the measure light in a given area. The integrated density in the above table is found by taking the integrated density of the sample and subtracting the background noise from that | ||
| - | * '''DNA μg/mL''' = 2 * ( integrated density of sample / integrated density of positive control) | + | * '''DNA μg/mL''' = 2 * ( integrated density of sample / integrated density of positive control(calf thymus)) |
* '''Conclusion''' = If the DNA μg/mL is greater than 1 than the sample has indeed replicated. If the sample is less than 1 than it has not shown exponential replication. | * '''Conclusion''' = If the DNA μg/mL is greater than 1 than the sample has indeed replicated. If the sample is less than 1 than it has not shown exponential replication. | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
When we unplugged the LCD display wire(part 3) from the Arudnio chip(part 6), the screen turned off. Everything on the PCR was working fine expect there was no output on the display. When we unplugged the white wire that connects Arudino chip(part 6) to thermal cycler (part 2), the reading from the screen dropped to -40 degrees Celsius. We disconnected the wire multiple times and each time the screen displayed -40 degrees Celsius.
We ran a test run on 10/25/2012. For this test we placed some empty PCR tubes into the machine and ran a simple test program on the Open PCR software. After the simple test was over we noticed that the display screen on the Open PCR lid matched very closely with what was displayed on our computer screen. The agreement between our computer screen and our PCR display meant that our diagnostic test was a success.
ProtocolsPolymerase Chain Reaction Polymerase Chain Reaction Procedure: 2.)We labeled 8 empty PCR tubes. For the first sample we labeled the 3 DNA samples 1A, 1B and 1C. For the second sample we labeled the tubes 2A, 2B and 2C. For the positive and negative controls, we labeled the tubes + and - respectively. 3.)Using one pipette per sample, to avoid contamination, we transferred the PCR reaction mix we were given to the PCR tubes. 4.)We then placed the samples in the PCR machine 5.)We set our PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius.
Fluorimeter Assembly
Fluorimeter Procedure: 2.)With the permanent marker we also labeled the Eppendrof tubes at the top, we had a total of 10 Eppendrof tubes labeled and 10 pipettes labeled. 3.)We transferred each sample separately into the Eppendorf tubes containing 400 ml of buffer. 4.)Using a specially labeled Eppendorf tube containing SYBR GREEN, with its own pippter, we placed two drops onto the first two center drops. 5.)Then using the sample we placed two drops on top of the SYBR GREEN solution drops 6.)Then we aligned the blue light to pass through the drop. 7.)Then the smartphone operator took a picture with the settings on the phone adjusted to inactive flash, iso to 800, white balance to auto, exposure to the highest setting and contrast to the lowest setting. 8.)This process was repeated for all samples 9.)After picture was taken it was given to the Image J software
Image J Procedure: 2.) Using the menu selection we used, image > color > split channels 3.) This created 3 files: a red, green and blue image. We only used the green image. 4.) Then we clicked the menu bar to activate the oval selection. 5.) We drew an oval around the image of our sample and then selected analyze > measure. 6.) We then simply moved the previously drawn oval to an area away from the sample to obtain the noise measurements. 7.) We repeated this process for all of the samples, including the controls.
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology In order to isolate and detect the cancer-causing gene, we essentially added a very specific primer that attaches to the cancer gene on the DNA. This Primer will not only allow for replication of the DNA, but more specifically, replication of the cancer gene in the DNA sample. The Open PCR machine then manipulates the temperature of the sample to facilitate the constant replication of the isolated DNA strands. We cycled the machine 30 times (the DNA was replicated 30 times) to be sure we had enough of the cancer DNA present in our solution. By understanding the mechanism of the Open PCR, we can intuitively understand how genes with specific diseases - such as cancer - are amplified. It is now necessary to learn how to identify which samples contain those replicated genes. The rs17879961 cancer-associated sequence in particular, can be identified within the DNA because of the single nucleotide variation - in this case a missense mutation - in its gene code. The mutation will yield a positive identification marker for cancer when the nucleotide cytosine is replaced by thymine in a very specific section of the DNA. Original Code: Code with SNP: Our research of the DNA sequence rs17879961 reveals that the gene sequence is correlated most directly to Breast and Colorectal Cancer. The Protocol section explains how the Open PCR amplifies this specific DNA sequence. A non-cancer DNA sequence would not produce a signal because the primer would not bind to the DNA and therefore would not allow for any replication. Only when we have the specific missense mutation can we replicate the cancer gene and identify a positive signal from the DNA. Although we determined that the DNA sequence rs17879961 was correlated to the Breast and Colorectal cancer, we must look at Baye's rule and other statistics to understand the likelihood that the gene will in fact lead to the development and spread of the cancer. Bayesian reasoning accounts for the prevalence, sensitivity, specificity and false positive rates of a disease in order to further understand that disease. Sensitivity is the likelihood that a person afflicted with the disease will test positive for it, while specificity is the likelihood that a person without the disease will test negative for it. Conditional probabilities of a sample of 180 people in Finland determined that the frequency of this cancer found in Finland was 7.8%. The genotype of this single nucleotide polymorphism change from cytosine to thymine in this population was 1.1% and the genotype without the SNP was found to be 98.9%. For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961. BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images. 1.) Both of the above images: http://users.ugent.be/~avierstr/principles/pcr.html
Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




