BME103:T930 Group 2 l2

From OpenWetWare

Revision as of 14:12, 28 November 2012 by Aaron A Cornejo (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Ryan SullivanResearch Development Scientist
Ryan Sullivan
Research Development Scientist
Miriam Y AcostaPCR Machine Engineer
Miriam Y Acosta
PCR Machine Engineer
Ryan KeeneyPCR Machine Engineer
Ryan Keeney
PCR Machine Engineer
Juliana RamosExperimental Protocol Planner
Juliana Ramos
Experimental Protocol Planner
Aaron CornejoExperimental Protocol Planner
Aaron Cornejo
Experimental Protocol Planner

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
Open PCR Machine 1
10 μM Forward Primer 16.0 μL
10 μM Reverse Primer 16.0 μL
GoTaq Master Mix 800.0 μL
dH2O 764.8 μL
Eppendorf Tubes 16
Fluorimeter 1
Teflon Glass Slides 16
Allen Wrench 1
Operations Manual 1
Supplied by User Amount
Screwdriver 1
Template DNA (20ng) 3.2 μL
Micro-Pipetter 1
Camera Phone 1


PCR Protocol



DNA Measurement Protocol

1.

Research and Development

Background on Disease Markers

  • Sample A

Sickle Cell Anemia

rs35685286 [Homo sapiens]

GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC

Chromosome 11- single nucleotide variation

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286


  • Sample B

Sickle Cell Anemia

rs34430836 [Homo sapiens]

AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG

Chromosome 11- single nucleotide variation

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836


Disease Description

Sickle cell anemia is an inherited blood disorder characterized primarily by chronic anemia and periodic episodes of pain. The underlying problem involves hemoglobin, a component of red blood cells. Hemoglobin molecules in each red blood cell carry oxygen from the lungs to body organs and tissues and bring carbon dioxide back to the lungs.

In sickle cell anemia, the hemoglobin is defective. After hemoglobin molecules give up their oxygen, some may cluster together and form long, rod-like structures. These structures cause red blood cells to become stiff and assume a sickle shape.

Unlike normal red cells, which are usually smooth and donut-shaped, sickled red cells cannot squeeze through small blood vessels. Instead, they stack up and cause blockages that deprive organs and tissues of oxygen-carrying blood. This process produces periodic episodes of pain and ultimately can damage tissues and vital organs and lead to other serious medical problems. Normal red blood cells live about 120 days in the bloodstream, but sickled red cells die after about 10 to 20 days. Because they cannot be replaced fast enough, the blood is chronically short of red blood cells, a condition called anemia.


Inheritance

Sickle cell anemia is an autosomal recessive genetic disorder caused by a defect in the HBB gene, which codes for hemoglobin. The presence of two defective genes (SS) is needed for sickle cell anemia. If each parent carries one sickle hemoglobin gene (S) and one normal gene (A), each child has a 25% chance of inheriting two defective genes and having sickle cell anemia; a 25% chance of inheriting two normal genes and not having the disease; and a 50% chance of being an unaffected carrier like the parents.

Source: http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/sca.shtml


Primer Design

  • Sample A

rs35685286 [Homo sapiens]

Primer--CTCCGGGACCTGTCCAACCAT

Reverse Primer-- GAGGCCCTGGACAGGTTGGTA


  • Sample B

rs34430836 [Homo sapiens]

Primer--ATCACTACCGGACCGAGTGGA

Reverse Primer--TAGTGATGGCCTGGCTCACCT


Illustration


Personal tools