BME103:T930 Group 2 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 116: Line 116:
[[Sickle Cell Anemia]]
[[Sickle Cell Anemia]]
-
rs35685286 [Homo sapiens]
+
''rs35685286 [Homo sapiens]''
GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC
GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC
Line 130: Line 130:
[[Sickle Cell Anemia]]
[[Sickle Cell Anemia]]
-
rs34430836 [Homo sapiens]
+
''rs34430836 [Homo sapiens]''
AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG
AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG

Revision as of 23:05, 27 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Ryan SullivanResearch Development Scientist
Ryan Sullivan
Research Development Scientist
Miriam Y AcostaPCR Machine Engineer
Miriam Y Acosta
PCR Machine Engineer
Ryan KeeneyPCR Machine Engineer
Ryan Keeney
PCR Machine Engineer
Juliana RamosExperimental Protocol Planner
Juliana Ramos
Experimental Protocol Planner
Aaron CornejoExperimental Protocol Planner
Aaron Cornejo
Experimental Protocol Planner

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
Open PCR Machine 1
10 μM Forward Primer 16.0 μL
10 μM Reverse Primer 16.0 μL
GoTaq Master Mix 800.0 μL
dH2O 764.8 μL
Tubes 16
Fluorimeter 1
Teflon Glass Slides 16
Alan Wrench 1
Operations Manual 1
Supplied by User Amount
Screwdriver 1
Template DNA (20ng) 3.2 μL
Micro-Pipetter 1
Camera Phone 1


PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

  • Sample A

Sickle Cell Anemia

rs35685286 [Homo sapiens]

GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC

Chromosome 11- single nucleotide variation

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286


  • Sample B

Sickle Cell Anemia

rs34430836 [Homo sapiens]

AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG

Chromosome 11- single nucleotide variation

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836


Primer Design

  • Sample A

rs35685286 [Homo sapiens]

Primer--CTCCGGGACCTGTCCAACCAT

Reverse Primer-- GAGGCCCTGGACAGGTTGGTA


  • Sample B

rs34430836 [Homo sapiens]

Primer—ATCACTACCGGACCGAGTGGA

Reverse Primer—TAGTGATGGCCTGGCTCACCT


Illustration


Personal tools