BME103:T930 Group 17 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions Protocols Materials Supplied in the Kit Amount PCR Machine 1 Programming Software Access 1--Online USB Connector 1 Power Cord 1 Sample Tubes 1 set-- Total:8 Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix) 10 experiments Eye Droppers (Disposable) 10 Supplied by User Amount DNA to Test User Discretion Computer Access 1 Power Source Access 1 Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix)--if needed Extra fluid ordered online Eye Droppers (Disposable)--if needed Extra droppers ordered online PCR Protocol 1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s). 2. Place template DNA into a test tube. 3. Add Primer 1 to the test tube. It will attach to the first binding site on one end of the template DNA. 4. Add Primer 2 to the test tube. It will attach to the second binding site on the opposite side of the template DNA. 5. Add nucleotides (dNTP’s) to the test tube. These free floating nucleotides will be used when extending the template DNA. 6. Add Taq polymerase to the test tube. This enzyme will bind to the specific priming site and replicate DNA at the end of the strand by adding nucleotides. 7. Add Magnesium Chloride, a cofactor that will bind to Taq polymerase and allow for greater efficiency, to the test tube. 8. Download the Open PCR software onto the computer. 9. Plug the Open PCR machine into an electrical outlet. 10. Connect the machine to the computer using the USB cable. 11. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten! 12. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius. 13. Start the new program. 14. Wait for program to run to completion. DNA Measurement Protocol Research and Development Background on Disease Markers Alzheimer’s disease is the slow deterioration of the brain. There is no known cure for this disease and it eventually results in death. This disease usually begins with the inability to remember things that have recently happened and in the late stages patients will have much difficulty in remembering basic cognitive functions. The specific missense mutation that I am examining changes a Thymine to a Guanine on the ninth chromosome. This mutation has a 3.8 times increased risk for an early onset of Alzheimer’s. The data reference number is Rs908832. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=908832 Cystic Fibrosis is caused by a mutation of the protein cystic fibrosis transmembrane conductance regulator. This protein regulates the movement of chloride and sodium ions. Symptoms include slow growth, accumulation of mucus, chest infections, coughing, and shortness of breath. The average patient will be able to live 37 years. The specific mutation I am looking at is a deletion of three nucleotides on the seventh chromosome and causes the deletion of phenylalanine from the polypeptide. In 1979 about 70% of all cystic fibrosis patients carried this mutation. The data reference number is rs113993960. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=113993960 Primer Design When testing the Alzheimer’s mutation the forward primer will be TGGCTCCACCACCTCGTGCCC and the reverse primer will be TTTGTGGGGCACGAGGTGGTG. When testing for the cystic fibrosis mutation the forward primer will be TCTTTTATAGTAACCACAAA and the reverse primer will be AACACCAAAGATATTTTCTT. Illustration