BME103:T930 Group 17

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 69: Line 69:
-
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
+
 

Revision as of 12:53, 8 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Doug Steinhauff (R&D Scientist)
Name: Doug Steinhauff (R&D Scientist)
Name: Carson Bridgers (DNA Measurement Operator)
Name: Carson Bridgers (DNA Measurement Operator)
Name: Kathleen Farrell (Protocol and Procedures)
Name: Kathleen Farrell (Protocol and Procedures)
Name: Kaleia Kramer (ImageJ Software Processor)
Name: Kaleia Kramer (ImageJ Software Processor)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design
Image:Overall_machine.png

This is an Open PCR Machine.

An Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is denaturation where the first cycling event heats the DNA strands at a temperature of 95 degrees celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step

Experimenting With the Connections

When the LCD Monitor was unplugged from the Open PCR Circuit Board the monitor lost power.

When we unplugged the white wire that connects the Open PCR Circuit Board to the Sample Holder/Heating Block, the LCD monitor incorrectly displayed the temperatue. Instead of displaying the correct temperature of 25 degrees celsius it diplayed a temperature of -40 degrees Celsius.


Test Run

We first tested our PCR machine on 10/18/12. The machine malfunctioned due to lack of heat management and would not cool. It was later discovered that several internal wires had been unconnected. These were later reconnected and resulted in properly functioning tests.




Protocols

Polymerase Chain Reaction

(Add your work from Week 3, Part 1 here)


Flourimeter Measurements

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

The specific DNA sequence that we are investigating is the r17879961 cancer associated sequence. This point mutation will change a thymine in a normal DNA strand to a cytosine in a mutated DNA strand. This mutation will result in an amino acid change of isoleucine to threonine when translated into an amino acid sequence. The primer designed for this single DNA mutation that causes cancer is able to bind to the template strand only if the mutation for cancer is present, which will allow for TAQ polymerase to extend the DNA. If the mutation is not present then the primer cannot bind and will therefore not be able to be extended resulting in a negative PCR reaction and amplification will not occur. The primers that we will use for this specific PCR have a sequence of AAACTCTTACACTGCATACA and CAGGACAAATTTCCTCCTAT.






Results

(Your group will add the results of your Fluorimeter measurements from Week 4 here)


Personal tools