BME103:T930 Group 17
From OpenWetWare
(→Protocols) |
Current revision (10:39, 15 November 2012) (view source) (→Results) |
||
| (30 intermediate revisions not shown.) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| - | | [[Image: | + | | [[Image:Doug Steinhauff.jpg|100px|thumb| Doug Steinhauff (R&D Scientist)]] |
| - | | [[Image: | + | | [[Image:CarsonBridgers.jpg|100px|thumb| Carson Bridgers (DNA Measurement Operator and PCR machine operator) ]] |
| - | | [[Image: | + | | [[Image:399013 328732870488811 483210505 n.jpg|100px|thumb| Kathleen Farrell (Protocol and Procedures)]] |
| - | | [[Image: | + | | [[Image:385430_10150382756581863_296847512_n.jpg|100px|thumb| Kaleia Kramer (ImageJ Software Processor and PCR machine operator)]] |
|} | |} | ||
=LAB 1 WRITE-UP= | =LAB 1 WRITE-UP= | ||
| - | |||
| - | == | + | == '''The Original Design'''<br> == |
| - | |||
| - | |||
[[Image:Overall_machine.png|200px]] <br> | [[Image:Overall_machine.png|200px]] <br> | ||
'''This is an Open PCR Machine.''' <br> | '''This is an Open PCR Machine.''' <br> | ||
| - | An Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees | + | An Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees Celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is to denature the protein, where the first cycling event heats the DNA strands at a temperature of 95 degrees Celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees Celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step, which differs depending on the polymerase used; typically the optimum temperature is around 75 degrees Celsius. During the elongation process, DNA polymerase synthesizes a complementary new strand of anti-parallel DNA. The amount of time required for elongation differs depending on the DNA polymerase used as well as the length of the amplified DNA fragments being used. On average, DNA polymerase amplifies at a rate of one thousand bases per minute. Next is the final elongation step where the temperature is held around 75 degrees Celsius to ensure that the DNA strand is fully elongated and will generally hold for around five minutes. Finally there is an end hold temperature that keeps the reaction at a steady temperature (between four and fifteen degrees) until the amplified DNA is ready to be utilized and further studied. |
| - | [[Image:LCD_monitor_and_PCB_board_part_3.png| | + | [[Image:LCD_monitor_and_PCB_board_part_3.png|100px]] <br> |
| - | + | '''This is the LCD monitor and the PCB board''' <br> | |
| - | + | The LCD monitor serves the purpose of informing the user of the temperature of the lid as well as the temperature of the samples. This serves as a visual verification that the program is running according to plan and follow along with the timing and temperatures involved in Open PCR experiments. | |
| - | [[Image: | + | [[Image:Heat_Sink_&_Fan_part_4.png|100px]] <br> |
| - | + | '''This is the Heat Sink and Fan''' <br> | |
| + | In this image the heat sink and fan have been isolated from the machine. These are used to keep the machine cool and running. When the cooling cycles begin the fan will increase speed to gradually decrease the temperature. | ||
| - | |||
| - | + | [[Image:Open_PCR_circuit_board.png|100px]] <br> | |
| - | + | '''This is the Open PCR Circuit Board''' <br> | |
| + | |||
| + | In this image the circuit board has been isolated from the machine. The circuit board is used to support all of the electronic components. All of the wires connecting the fan, the LCD monitor, power supplies, and the heat sink all of which work together to ensure the functionality of the machine | ||
| + | |||
| + | |||
| + | [[Image:PCR_machine_part_5.png|100px]] <br> | ||
| + | |||
| + | '''This is the PCR machine''' <br> | ||
| + | |||
| + | In this image the power supply has been isolated from the machine. The power supply provides energy for all of the components in the PCR Machine. | ||
| + | |||
| + | |||
| + | [[Image:PCR_sample_holder_part_2.png|100px]] <br> | ||
| + | |||
| + | '''This is the Sample Holder''' <br> | ||
| + | |||
| + | In this image the top has been moved aside so that the sample holder is visible. The sample holder keeps the samples in place while the PCR machine cycles. The heated lid tightens so that the inside of the lid will press against the samples without crushing them to ensure that they are heated quickly and evenly. | ||
| + | |||
| + | |||
| + | =='''Experimenting With the Connections'''<br>== | ||
| + | |||
| + | When the LCD Monitor was unplugged from the Open PCR Circuit Board the monitor lost power. | ||
| + | When we unplugged the white wire that connects the Open PCR Circuit Board to the Sample Holder/Heating Block, the LCD monitor incorrectly displayed the temperature. Instead of displaying the correct temperature of 25 degrees Celsius it displayed a temperature of -40 degrees Celsius. | ||
| - | |||
| - | + | =='''Test Run'''== | |
| + | We first tested our PCR machine on 10/18/12. The machine malfunctioned due to lack of heat management and would not cool. It was later discovered that several internal wires were disconnected. A different machine was procured, tested, and found to work. This new machine was used for all of the experiments. | ||
<br><br> | <br><br> | ||
| Line 166: | Line 185: | ||
'''Part III: Saving Images Procedure:''' | '''Part III: Saving Images Procedure:''' | ||
| - | + | <br> | |
| - | + | 1. Set up the fluorimeter.<br> | |
| + | 2. Take picture of the specimen (droplet) using a cell phone camera.<br> | ||
| + | 3. E-mail picture to computer that contains Image J software.<br> | ||
| + | 4. Save image to computer and upload into Image J.<br> | ||
| + | 5. Analyze specimen by "drawing" a circle that outlines the droplet from the image.<br> | ||
| + | 6. Save data in Word Excel.<br> | ||
| + | 7. Repeat steps 2-6 for all images.<br> | ||
<br><br> | <br><br> | ||
| Line 176: | Line 201: | ||
The specific DNA sequence that we are investigating is the r17879961 cancer associated sequence. This point mutation will change a thymine in a normal DNA strand to a cytosine in a mutated DNA strand. This mutation will result in an amino acid change of isoleucine to threonine when translated into an amino acid sequence. | The specific DNA sequence that we are investigating is the r17879961 cancer associated sequence. This point mutation will change a thymine in a normal DNA strand to a cytosine in a mutated DNA strand. This mutation will result in an amino acid change of isoleucine to threonine when translated into an amino acid sequence. | ||
| - | The primer designed for this single DNA mutation that causes cancer is able to bind to the template strand only if the mutation for cancer is present, which will allow for TAQ polymerase to extend the DNA. If the mutation is not present then the primer cannot bind and will therefore not be able to be extended resulting in a negative PCR reaction | + | The primer designed for this single DNA mutation that causes cancer is able to bind to the template strand only if the mutation for cancer is present, which will allow for TAQ polymerase to extend the DNA. If the mutation is not present then the primer cannot bind and will therefore not be able to be extended resulting in a negative PCR reaction as amplification will not occur. The primers that we will use for this specific PCR have a sequence of AAACTCTTACACTGCATACA and CAGGACAAATTTCCTCCTAT. |
| Line 185: | Line 210: | ||
<br><br> | <br><br> | ||
| - | + | '''Bayes's Theorem:''' | |
| + | p(A|X) = [ p(X|A)*p(A)] / [ P(X|A)*p(A) + p(X|~A)*p(~A) ] | ||
| + | This theorem demonstrates the probability of some event happening based on a certain observation. A is the given phenomenon, while X is some observation of the phenomenon. In our case the phenomenon was either positive for cancer or negative for cancer and the observation of the phenomenon was weather it was positive or negative. | ||
| + | Therefore, we had two equations derived from this model: | ||
| - | + | PPV = TP/(TP+FP) | |
| + | PPV is positive prediction value | ||
| + | TP is true positive | ||
| + | FP is false positive | ||
| + | This gives you the probability that someone actually does have cancer. | ||
| + | and | ||
| - | < | + | NPV = TN/(TN + FN) |
| + | NPV is negative prediction value | ||
| + | TN is true negative | ||
| + | FN is false negative | ||
| + | This gives you the probability that someone does not have cancer. | ||
| + | |||
| + | == '''Results''' <br>== | ||
| + | |||
| + | [[Image:100MEDIA$IMAG0083.jpg|150px|thumb|bottom|Water]] | ||
| + | |||
| + | [[Image:100MEDIA$IMAG0085.jpg|150px|thumb|bottom|Calf Thymus]] | ||
| + | |||
| + | |||
| + | '''Original Recorded ImageJ Data''' <br> | ||
| + | {| {{table}} | ||
| + | |- style="background:#f0f0f0;" | ||
| + | | '''Sample Name''' || '''Area''' || ''' Mean''' || '''Raw Integrated Density''' || '''Integrated Density''' | ||
| + | |- | ||
| + | | PCR: Water Trial (drop) || 22588 || 90.925 || 2053819 || 2053819 | ||
| + | |- | ||
| + | | PCR: Water Trial (background)l || 24711 || 27.044 || 668287 || 668287 | ||
| + | |- | ||
| + | | PCR: Negative Control (drop) || 25608 || 88.317 || 2261618 || 2261618 | ||
| + | |- | ||
| + | | PCR: Negative Control (background) || 24819 || 22.568 || 560108 || 560108 | ||
| + | |- | ||
| + | | PCR: Calf Thymus (Positive) (drop) || 24961 || 118.833 || 2966194 || 2966194 | ||
| + | |- | ||
| + | | PCR: Calf Thymus (Positive) (background) || 22860 || 122.817 || 2807604 || 2807604 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 1 (drop) || 21232 || 80.643 || 1712217 || 1712217 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 1 (background) || 24577 || 3.07 || 75458 || 75458 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 2 (drop) || 30988 || 92.088 || 2853614 || 2853614 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 2 (background) || 28180 || 31.919 || 899464 || 899464 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID22345#, rep 3 (drop) || 28878 || 84.477 || 2439513 || 2439513 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 3 (background) || 31522 || 7.076 || 223042 || 223042 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 1 (drop) || 20632 || 111.722 || 2305058 || 2305058 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 1 (background) || 20088 || 97.416 || 1956900 || 1956900 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 2 (drop) || 13428 || 128.761 || 1728999 || 1728999 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 2 (background) || 13082 || 133.966 || 1752545 || 1752545 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 3 (drop) || 23100 || 102.688 || 2372096 || 2372096 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 3 (background) || 23362 || 124.369 || 2905517 || 2905517 | ||
| + | |} | ||
| + | |||
| + | |||
| + | |||
| + | '''Supporting Analysis''' <br> | ||
| + | {| {{table}} | ||
| + | |- style="background:#f0f0f0;" | ||
| + | | '''Sample Name''' || '''Integrated Density (drop)''' || '''Integrated Density (background) || ''' Integrated Density with Subtracted Background''' || '''DNA μg/mL''' || '''Conclusion''' | ||
| + | |- | ||
| + | | PCR: Water Trial || 2053819 || 668287 || 1385532 || none || Negative | ||
| + | |- | ||
| + | | PCR: Negative Control || 2261618 || 560108 || 1701510 || 0.3349 || Negative | ||
| + | |- | ||
| + | | PCR: Positive Contro: Calf Thymus || 2966194 || 2807604 || 10158590 || 2.0000 || Calf Thymus Positive | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 1 || 1712217 || 75458 || 1636759 || 0.3222 || Negative | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 2 || 2853614 || 899464 || 1954150 || 0.3847 || Negative | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 3 || 2439513 || 223042 || 2216471 || 0.4364 || Negative | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 1 || 2305058 || 1956900 || 348158 || 0.685 || Negative | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 2 || 1728999 || 1752545 || -23546 || -0.0046 || Negative | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 3 || 2372096 || 2905517 || -533421 || -0.1096 || Negative | ||
| + | |} | ||
| + | |||
| + | |||
| + | '''Final Results''' <br> | ||
{| {{table}} | {| {{table}} | ||
|- style="background:#f0f0f0;" | |- style="background:#f0f0f0;" | ||
| '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | | '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | ||
|- | |- | ||
| - | | PCR: | + | | PCR: Water Trial || 1385532 || None || Negative |
|- | |- | ||
| - | | PCR: | + | | PCR: Negative Control || 1701510 || 0.3349 || Negative |
|- | |- | ||
| - | | PCR: | + | | PCR: Positive Contro: Calf Thymus l || 10158590 || 2.0000 || Positive |
|- | |- | ||
| - | | PCR: Patient 1 ID | + | | PCR: Patient 1 ID 22345, rep 1 || 1636759 || 0.3222 || Negative |
|- | |- | ||
| - | | PCR: Patient 1 ID | + | | PCR: Patient 1 ID 22345, rep 2 || 1954150 || 0.3847 || Negative |
|- | |- | ||
| - | | PCR: Patient | + | | PCR: Patient 1 ID 22345, rep 3 || 2216471 || 0.4364 || Negative |
|- | |- | ||
| - | | PCR: Patient 2 ID | + | | PCR: Patient 2 ID 33167, rep 1 || 348158 || 0.6850 || Negative |
|- | |- | ||
| - | | PCR: Patient 2 ID | + | | PCR: Patient 2 ID 33167, rep 2 || -23546 || -0.0046 || Negative |
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 3 || -533421 || -0.1096 || Negative | ||
|} | |} | ||
| - | + | '''Further Explanations and Work''' <br> | |
| - | + | [[Image:BME103 OpenPCR table.xls|150px|thumb|right|Calf Thymus]] | |
| - | + | ||
| - | + | ||
| - | + | ||
| + | The attached link is a downloadable copy of the above tables which serve to further show additional planning, work and calculations. | ||
| + | |||
| + | KEY | ||
| + | * '''Sample''' = Provides an identification number or some sort of context supporting the information provided | ||
| + | * '''Area''' = Area of the water droplet measured in pixels | ||
| + | * '''Mean''' = The average amount of grey area pixels in the selected region of the water droplet | ||
| + | * '''Integrated Density''' = The area multiplied by the mean | ||
| + | * '''Raw Integrated Density''' = The calculated sum of all the pixels provided in the selected region | ||
| + | * '''DNA μg/mL''' = By incorporating knowledge of the integrated density and the DNA concentration of the positive control, the DNA concentration of each can be calculated using the following formula: x = 2.0 * sample INTDEN with background subtracted / calf thymus INTDEN with background subtracted | ||
| + | * '''Conclusion''' = If the DNA concentration was > 1μg/mL then the sample is considered to exhibit a positive result. If the DNA concentration was < 1μg/mL then the sample is considered to exhibit a negative result or no signal. | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP The Original Design
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Reagent | Volume | |
|---|---|---|
| Template DNA (20 ng) | .2μL | |
| 10 μM Forward Primer | 1.0 μL | |
| 10 μM Reverse Primer | 1.0 μL | |
| GoTaq Master Mix | 50.0 μL | |
| dH2O | 47.8 μL | |
| Total Volume | 100.0 μL |
Part V: Patient Sample Description:
| Patient ID | Sex | Age |
|---|---|---|
| 22345 | Male | 65 |
| 33167 | F | 23 |
Flourimeter Measurements
Part 1: Photos of Assembly:
Part II: Assembly Procedure:
1. Obtain a fluorimeter box that contains crucial materials for the fluorimeter assembly.
2. Set up the box "upside-down" so that most of the light will be blocked from the inside.
3. Place the cell phone in the docking area.
4. Place the glass slide over the black container that marks designated areas for the water droplets with black dots.
5. Place the glass slide with container on top of black shelving.
Part III: Saving Images Procedure:
1. Set up the fluorimeter.
2. Take picture of the specimen (droplet) using a cell phone camera.
3. E-mail picture to computer that contains Image J software.
4. Save image to computer and upload into Image J.
5. Analyze specimen by "drawing" a circle that outlines the droplet from the image.
6. Save data in Word Excel.
7. Repeat steps 2-6 for all images.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
The specific DNA sequence that we are investigating is the r17879961 cancer associated sequence. This point mutation will change a thymine in a normal DNA strand to a cytosine in a mutated DNA strand. This mutation will result in an amino acid change of isoleucine to threonine when translated into an amino acid sequence. The primer designed for this single DNA mutation that causes cancer is able to bind to the template strand only if the mutation for cancer is present, which will allow for TAQ polymerase to extend the DNA. If the mutation is not present then the primer cannot bind and will therefore not be able to be extended resulting in a negative PCR reaction as amplification will not occur. The primers that we will use for this specific PCR have a sequence of AAACTCTTACACTGCATACA and CAGGACAAATTTCCTCCTAT.
Bayes's Theorem:
p(A|X) = [ p(X|A)*p(A)] / [ P(X|A)*p(A) + p(X|~A)*p(~A) ] This theorem demonstrates the probability of some event happening based on a certain observation. A is the given phenomenon, while X is some observation of the phenomenon. In our case the phenomenon was either positive for cancer or negative for cancer and the observation of the phenomenon was weather it was positive or negative. Therefore, we had two equations derived from this model:
PPV = TP/(TP+FP)
PPV is positive prediction value
TP is true positive
FP is false positive
This gives you the probability that someone actually does have cancer.
and
NPV = TN/(TN + FN)
NPV is negative prediction value
TN is true negative
FN is false negative
This gives you the probability that someone does not have cancer.
Results
Original Recorded ImageJ Data
| Sample Name | Area | Mean | Raw Integrated Density | Integrated Density |
| PCR: Water Trial (drop) | 22588 | 90.925 | 2053819 | 2053819 |
| PCR: Water Trial (background)l | 24711 | 27.044 | 668287 | 668287 |
| PCR: Negative Control (drop) | 25608 | 88.317 | 2261618 | 2261618 |
| PCR: Negative Control (background) | 24819 | 22.568 | 560108 | 560108 |
| PCR: Calf Thymus (Positive) (drop) | 24961 | 118.833 | 2966194 | 2966194 |
| PCR: Calf Thymus (Positive) (background) | 22860 | 122.817 | 2807604 | 2807604 |
| PCR: Patient 1 ID 22345, rep 1 (drop) | 21232 | 80.643 | 1712217 | 1712217 |
| PCR: Patient 1 ID 22345, rep 1 (background) | 24577 | 3.07 | 75458 | 75458 |
| PCR: Patient 1 ID 22345, rep 2 (drop) | 30988 | 92.088 | 2853614 | 2853614 |
| PCR: Patient 1 ID 22345, rep 2 (background) | 28180 | 31.919 | 899464 | 899464 |
| PCR: Patient 1 ID22345#, rep 3 (drop) | 28878 | 84.477 | 2439513 | 2439513 |
| PCR: Patient 1 ID 22345, rep 3 (background) | 31522 | 7.076 | 223042 | 223042 |
| PCR: Patient 2 ID 33167, rep 1 (drop) | 20632 | 111.722 | 2305058 | 2305058 |
| PCR: Patient 2 ID 33167, rep 1 (background) | 20088 | 97.416 | 1956900 | 1956900 |
| PCR: Patient 2 ID 33167, rep 2 (drop) | 13428 | 128.761 | 1728999 | 1728999 |
| PCR: Patient 2 ID 33167, rep 2 (background) | 13082 | 133.966 | 1752545 | 1752545 |
| PCR: Patient 2 ID 33167, rep 3 (drop) | 23100 | 102.688 | 2372096 | 2372096 |
| PCR: Patient 2 ID 33167, rep 3 (background) | 23362 | 124.369 | 2905517 | 2905517 |
Supporting Analysis
| Sample Name | Integrated Density (drop) | Integrated Density (background) | Integrated Density with Subtracted Background | DNA μg/mL | Conclusion |
| PCR: Water Trial | 2053819 | 668287 | 1385532 | none | Negative |
| PCR: Negative Control | 2261618 | 560108 | 1701510 | 0.3349 | Negative |
| PCR: Positive Contro: Calf Thymus | 2966194 | 2807604 | 10158590 | 2.0000 | Calf Thymus Positive |
| PCR: Patient 1 ID 22345, rep 1 | 1712217 | 75458 | 1636759 | 0.3222 | Negative |
| PCR: Patient 1 ID 22345, rep 2 | 2853614 | 899464 | 1954150 | 0.3847 | Negative |
| PCR: Patient 1 ID 22345, rep 3 | 2439513 | 223042 | 2216471 | 0.4364 | Negative |
| PCR: Patient 2 ID 33167, rep 1 | 2305058 | 1956900 | 348158 | 0.685 | Negative |
| PCR: Patient 2 ID 33167, rep 2 | 1728999 | 1752545 | -23546 | -0.0046 | Negative |
| PCR: Patient 2 ID 33167, rep 3 | 2372096 | 2905517 | -533421 | -0.1096 | Negative |
Final Results
| Sample | Integrated Density | DNA μg/mL | Conclusion |
| PCR: Water Trial | 1385532 | None | Negative |
| PCR: Negative Control | 1701510 | 0.3349 | Negative |
| PCR: Positive Contro: Calf Thymus l | 10158590 | 2.0000 | Positive |
| PCR: Patient 1 ID 22345, rep 1 | 1636759 | 0.3222 | Negative |
| PCR: Patient 1 ID 22345, rep 2 | 1954150 | 0.3847 | Negative |
| PCR: Patient 1 ID 22345, rep 3 | 2216471 | 0.4364 | Negative |
| PCR: Patient 2 ID 33167, rep 1 | 348158 | 0.6850 | Negative |
| PCR: Patient 2 ID 33167, rep 2 | -23546 | -0.0046 | Negative |
| PCR: Patient 2 ID 33167, rep 3 | -533421 | -0.1096 | Negative |
Further Explanations and Work
Image:BME103 OpenPCR table.xls
The attached link is a downloadable copy of the above tables which serve to further show additional planning, work and calculations.
KEY
- Sample = Provides an identification number or some sort of context supporting the information provided
- Area = Area of the water droplet measured in pixels
- Mean = The average amount of grey area pixels in the selected region of the water droplet
- Integrated Density = The area multiplied by the mean
- Raw Integrated Density = The calculated sum of all the pixels provided in the selected region
- DNA μg/mL = By incorporating knowledge of the integrated density and the DNA concentration of the positive control, the DNA concentration of each can be calculated using the following formula: x = 2.0 * sample INTDEN with background subtracted / calf thymus INTDEN with background subtracted
- Conclusion = If the DNA concentration was > 1μg/mL then the sample is considered to exhibit a positive result. If the DNA concentration was < 1μg/mL then the sample is considered to exhibit a negative result or no signal.



