BME103:T930 Group 17
From OpenWetWare
(→Protocols) |
(→Results) |
||
| Line 262: | Line 262: | ||
|- | |- | ||
| PCR: Patient 2 ID 33167, rep 3 || 2372096 || 2905517 || -533421 || -0.1096 || Negative | | PCR: Patient 2 ID 33167, rep 3 || 2372096 || 2905517 || -533421 || -0.1096 || Negative | ||
| + | |} | ||
| + | |||
| + | {| {{table}} | ||
| + | |- style="background:#f0f0f0;" | ||
| + | | '''Sample Name''' || '''Area''' || ''' Mean''' || '''Raw Integrated Density''' || '''Integrated Density''' | ||
| + | |- | ||
| + | | PCR: Water Trial (drop) || 22588 || 90.925 || 2053819 || 2053819 | ||
| + | |- | ||
| + | | PCR: Water Trial (background)l || 24711 || 27.044 || 668287 || 668287 | ||
| + | |- | ||
| + | | PCR: Negative Control (drop) || 25608 || 88.317 || 2261618 || 2261618 | ||
| + | |- | ||
| + | | PCR: Negative Control (background) || 24819 || 22.568 || 560108 || 560108 | ||
| + | |- | ||
| + | | PCR: Calf Thymus (Positive) (drop) || 24961 || 118.833 || 2966194 || 2966194 | ||
| + | |- | ||
| + | | PCR: Calf Thymus (Positive) (background) || 22860 || 122.817 || 2807604 || 2807604 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 1 (drop) || 21232 || 80.643 || 1712217 || 1712217 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 1 (background) || 24577 || 3.07 || 75458 || 75458 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 2 (drop) || 30988 || 92.088 || 2853614 || 2853614 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 2 (background) || 28180 || 31.919 || 899464 || 899464 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID22345#, rep 3 (drop) || 28878 || 84.477 || 2439513 || 2439513 | ||
| + | |- | ||
| + | | PCR: Patient 1 ID 22345, rep 3 (background) || 31522 || 7.076 || 223042 || 223042 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 1 (drop) || 20632 || 111.722 || 2305058 || 2305058 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 1 (background) || 20088 || 97.416 || 1956900 || 1956900 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 2 (drop) || 13428 || 128.761 || 1728999 || 1728999 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 2 (background) || 13082 || 133.966 || 1752545 || 1752545 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 3 (drop) || 23100 || 102.688 || 2372096 || 2372096 | ||
| + | |- | ||
| + | | PCR: Patient 2 ID 33167, rep 3 (background) || 23362 || 124.369 || 2905517 || 2905517 | ||
|} | |} | ||
Revision as of 02:47, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) The Original Design
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Reagent | Volume | |
|---|---|---|
| Template DNA (20 ng) | .2μL | |
| 10 μM Forward Primer | 1.0 μL | |
| 10 μM Reverse Primer | 1.0 μL | |
| GoTaq Master Mix | 50.0 μL | |
| dH2O | 47.8 μL | |
| Total Volume | 100.0 μL |
Part V: Patient Sample Description:
| Patient ID | Sex | Age |
|---|---|---|
| 22345 | Male | 65 |
| 33167 | F | 23 |
Flourimeter Measurements
Part 1: Photos of Assembly:
Part II: Assembly Procedure:
1. Obtain a fluorimeter box that contains crucial materials for the fluorimeter assembly.
2. Set up the box "upside-down" so that most of the light will be blocked from the inside.
3. Place the cell phone in the docking area.
4. Place the glass slide over the black container that marks designated areas for the water droplets with black dots.
5. Place the glass slide with container on top of black shelving.
Part III: Saving Images Procedure:
1. Set up the fluorimeter.
2. Take picture of the specimen (droplet) using a cell phone camera.
3. E-mail picture to computer that contains Image J software.
4. Save image to computer and upload into Image J.
5. Analyze specimen by "drawing" a circle that outlines the droplet from the image.
6. Save data in Word Excel.
7. Repeat steps 2-6 for all images.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
The specific DNA sequence that we are investigating is the r17879961 cancer associated sequence. This point mutation will change a thymine in a normal DNA strand to a cytosine in a mutated DNA strand. This mutation will result in an amino acid change of isoleucine to threonine when translated into an amino acid sequence. The primer designed for this single DNA mutation that causes cancer is able to bind to the template strand only if the mutation for cancer is present, which will allow for TAQ polymerase to extend the DNA. If the mutation is not present then the primer cannot bind and will therefore not be able to be extended resulting in a negative PCR reaction as amplification will not occur. The primers that we will use for this specific PCR have a sequence of AAACTCTTACACTGCATACA and CAGGACAAATTTCCTCCTAT.
Results
| Sample | Integrated Density | DNA μg/mL | Conclusion |
| PCR: Water Trial | 1385532 | None | Negative |
| PCR: Negative Control | 1701510 | 0.3349 | Negative |
| PCR: Positive Contro: Calf Thymus l | 10158590 | 2.0000 | Positive |
| PCR: Patient 1 ID 22345, rep 1 | 1636759 | 0.3222 | Negative |
| PCR: Patient 1 ID 22345, rep 2 | 1954150 | 0.3847 | Negative |
| PCR: Patient 1 ID 22345, rep 3 | 2216471 | 0.4364 | Negative |
| PCR: Patient 2 ID 33167, rep 1 | 348158 | 0.6850 | Negative |
| PCR: Patient 2 ID 33167, rep 2 | -23546 | -0.0046 | Negative |
| PCR: Patient 2 ID 33167, rep 3 | -533421 | -0.1096 | Negative |
| Sample Name | Integrated Density (drop) | Integrated Density (background) | Integrated Density with Subtracted Background | DNA μg/mL | Conclusion |
| PCR: Water Trial | 2053819 | 668287 | 1385532 | none | Negative |
| PCR: Negative Control | 2261618 | 560108 | 1701510 | 0.3349 | Negative |
| PCR: Positive Contro: Calf Thymus | 2966194 | 2807604 | 10158590 | 2.0000 | Calf Thymus Positive |
| PCR: Patient 1 ID 22345, rep 1 | 1712217 | 75458 | 1636759 | 0.3222 | Negative |
| PCR: Patient 1 ID 22345, rep 2 | 2853614 | 899464 | 1954150 | 0.3847 | Negative |
| PCR: Patient 1 ID 22345, rep 3 | 2439513 | 223042 | 2216471 | 0.4364 | Negative |
| PCR: Patient 2 ID 33167, rep 1 | 2305058 | 1956900 | 348158 | 0.685 | Negative |
| PCR: Patient 2 ID 33167, rep 2 | 1728999 | 1752545 | -23546 | -0.0046 | Negative |
| PCR: Patient 2 ID 33167, rep 3 | 2372096 | 2905517 | -533421 | -0.1096 | Negative |
| Sample Name | Area | Mean | Raw Integrated Density | Integrated Density |
| PCR: Water Trial (drop) | 22588 | 90.925 | 2053819 | 2053819 |
| PCR: Water Trial (background)l | 24711 | 27.044 | 668287 | 668287 |
| PCR: Negative Control (drop) | 25608 | 88.317 | 2261618 | 2261618 |
| PCR: Negative Control (background) | 24819 | 22.568 | 560108 | 560108 |
| PCR: Calf Thymus (Positive) (drop) | 24961 | 118.833 | 2966194 | 2966194 |
| PCR: Calf Thymus (Positive) (background) | 22860 | 122.817 | 2807604 | 2807604 |
| PCR: Patient 1 ID 22345, rep 1 (drop) | 21232 | 80.643 | 1712217 | 1712217 |
| PCR: Patient 1 ID 22345, rep 1 (background) | 24577 | 3.07 | 75458 | 75458 |
| PCR: Patient 1 ID 22345, rep 2 (drop) | 30988 | 92.088 | 2853614 | 2853614 |
| PCR: Patient 1 ID 22345, rep 2 (background) | 28180 | 31.919 | 899464 | 899464 |
| PCR: Patient 1 ID22345#, rep 3 (drop) | 28878 | 84.477 | 2439513 | 2439513 |
| PCR: Patient 1 ID 22345, rep 3 (background) | 31522 | 7.076 | 223042 | 223042 |
| PCR: Patient 2 ID 33167, rep 1 (drop) | 20632 | 111.722 | 2305058 | 2305058 |
| PCR: Patient 2 ID 33167, rep 1 (background) | 20088 | 97.416 | 1956900 | 1956900 |
| PCR: Patient 2 ID 33167, rep 2 (drop) | 13428 | 128.761 | 1728999 | 1728999 |
| PCR: Patient 2 ID 33167, rep 2 (background) | 13082 | 133.966 | 1752545 | 1752545 |
| PCR: Patient 2 ID 33167, rep 3 (drop) | 23100 | 102.688 | 2372096 | 2372096 |
| PCR: Patient 2 ID 33167, rep 3 (background) | 23362 | 124.369 | 2905517 | 2905517 |
Further Explanations and Work
Image:BME103 OpenPCR table.xls
The attached link is a downloadable copy of the above tables which serve to further show additional planning, work and calculations.
KEY
- Sample = Provides an identification number or some sort of context supporting the information provided
- Area = Area of the water droplet measured in pixels
- Mean = The average amount of grey area pixels in the selected region of the water droplet
- Integrated Density = The area multiplied by the mean
- Raw Integrated Density = The calculated sum of all the pixels provided in the selected region
- DNA μg/mL = By incorporating knowledge of the integrated density and the DNA concentration of the positive control, the DNA concentration of each can be calculated using the following formula: x = 2.0 * sample INTDEN with background subtracted / calf thymus INTDEN with background subtracted
- Conclusion = If the DNA concentration was > 1μg/mL then the sample is considered to exhibit a positive result. If the DNA concentration was < 1μg/mL then the sample is considered to exhibit a negative result or no signal.



