OUR TEAM
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
Key Features
Four solar panels will be added to the top of the PCR machine. This will allow the PCR machine to run on its own without having to plug it into an outlet; resulting in it being environmentally friendly while still being able to detect different diseases in DNA samples. A crystalized monitor will also be placed on the PCR's side panel. The monitor will display the current status of the sample that is being used, along with the amount of time left in the process. Eliminating the necessity of a computer during this process.
Instructions
1) Take the pre-cut solar panels and insert them into the modified top of the open PCR machine.
2) Once inserted, let these solar panels charge under the light.
3) To insert the crystalized monitor, screw it into the modified side of the open PCR machine. Before placing the monitor into the side of the PCR machine, make sure to connect the correct wires (directed by color) together in order for the monitor to operate.
Protocols
Materials
PCR Protocol
Before starting the experiment be sure that the solar panels on the PCR machine have been charged.
To prepare the DNA samples for the PCR, label the DNA test tubes with the patients name and replication number or label it in some way so that you will be able to distinguish between the patient sample and which replication it is (for example P1 R1 for patient one replication one). Put a corresponding label on the tubes containing the reaction mix that will be placed into the actual PCR. After you have labeled all of your patient samples and your positive and negative control, you are ready to add the samples to the PCR reaction mix. The reaction mix includes: Taq DNA polymerase, forward primer, reverse primer, MgCl2 and dNTP's. 100 mL of the reaction mix should be placed in the tubes. Using a different transfer pipette each time, transfer your DNA samples, and positive and negative controls to separate tubes of the reaction mix.
DNA Measurement Protocol
Research and Development
Background on Disease Markers
Group 16 decided to investigate cystic fibrosis, a disease that is caused by mutations in a specific gene on the seventh chromosome, and is then passed down through families as a recessive trait. In this disease, mucus accumulates inside the lungs, digestive tract, and other cavities in the body. This life-threatening disease is the most common chronic lung disease to affect children and is often diagnosable by the age of two. However, weaker strains can go undetected until early adulthood. The effects of this disease, however, have been mediated through the use of treatments that can postpone some of the changes that occur in the lungs. Half of the patients with cystic fibrosis live past 28 years, and patients who only have mucus buildup in the digestive tract are even better off. Gene therapy holds great promise for treating cystic fibrosis. The marker associated with cystic fibrosis is a two nucleotide deletion and has identity rs200007348. This two nucleotide deletion is due to an adenine-guanine swap that occurs in the codon TGG. A codon is a genetic code involved in the RNA process that impacts protein translation. When the TGG undergoes the adenine guanine swap, it becomes TGA which codes for the stop codon, ending protein translation. This SNP heightens susceptibility to cystic fibrosis, a disease with the frequency 1 out of 2000 in Europe and 1 out of 3500 in the United States
Primer Design
Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5'
Forward primer: 5' AAATATCTGGCTGAGTGTTT 3'
Cystic fibrosis is caused by a 3 bp deletion that leads to a protein which lacks a critical phenylalanine amino acid in the protein. PCR primers have been developed that can distinguish a normal gene from a mutant gene. With these primers a 154 bp product is produced from a normal individual and a 151 bp product is amplified from DNA of an individual with the disease. The disease allele is complementary which will result in a positive result in Open PCR. However, a regular allele cannot give a positive result because the lost nucleotides will be added back into the primer causing a frameshift mutation of three. Thus, these primers are built 151 bp apart and this shortens the temperature cycles from 30 seconds to 10 seconds.
Illustration

This diagram shows how membrane proteins are made and destroyed in cells. Membrane proteins comprise approximately 30% of all proteins encoded in genes and carry out numerous critical functions. The folding problem of membrane proteins is directly related to human health. Indeed, accumulation of misfolded membrane proteins is the primary determinant of cystic fibrosis.

Figure A shows large deletions of Exons 17a and 17 b in cystic fibrosis alleles, which have been estimated to occur in 1–2% pathogenic alleles. The occurrence of this deletion could be much higher in classical cystic fibrosis patients with one mutation detectable by the routine screening/sequencing work-up. A rearranged region is inserted where the deletion occurs, and is flanked by a pair of perfectly inverted repeats of 32 bp. Figure B shows the difference between a wild-type allele and a mutated allele. The wild-type allele and mutated allele have variable regions flanked by the inverted 32 bp repeats, (blue arrows) whose start and end are denoted by vertical dashed lines. The nucleotide sequence alignment of the variable regions are shown to be highly homologous. In the mutated allele, Exons 17a and 17b have been deleted and a 30 bp insertion takes its place.
|