BME103:T930 Group 16 - Revision history

Swetha A. Swaminathan: /* Protocols */

2012-11-15T18:22:47Z

Protocols

←Older revision		Revision as of 18:22, 15 November 2012
Line 100:		Line 100:
	Here is the patient information:		Here is the patient information:

-	Patient 1 ID Number: ~~92136~~	+	Patient 1 ID Number: 25654

-	*~~Male~~	+	*Female

-	*54 Years	+	*65 Years

-	Patient 2 ID Number: ~~62276~~	+	Patient 2 ID Number: 34311

	*Female		*Female

-	*61 Years	+	*19 Years

	'''Fluorimeter Measurements'''<br>		'''Fluorimeter Measurements'''<br>

Swetha A. Swaminathan: /* Research and Development */

2012-11-15T17:31:56Z

Research and Development

←Older revision		Revision as of 17:31, 15 November 2012
Line 156:		Line 156:
	The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.		The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.

-		+	Sources:
	*"CGDP - DNA Amplification, Part 1." CGDP - DNA Amplification, Part 1. N.p., n.d. Web. 08 Nov. 2012. <http://www.flmnh.ufl.edu/cowries/amplify.html>.		*"CGDP - DNA Amplification, Part 1." CGDP - DNA Amplification, Part 1. N.p., n.d. Web. 08 Nov. 2012. <http://www.flmnh.ufl.edu/cowries/amplify.html>.
	*"Principle of the PCR." Principle of the PCR. N.p., n.d. Web. 08 Nov. 2012. <http://users.ugent.be/~avierstr/principles/pcr.html>.		*"Principle of the PCR." Principle of the PCR. N.p., n.d. Web. 08 Nov. 2012. <http://users.ugent.be/~avierstr/principles/pcr.html>.

Swetha A. Swaminathan: /* Research and Development */

2012-11-15T17:31:29Z

Research and Development

←Older revision		Revision as of 17:31, 15 November 2012
Line 146:		Line 146:

	[[Image:pcrsteps.jpg]]<br>		[[Image:pcrsteps.jpg]]<br>
		+

	This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s.		This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s.
		+

	[[Image:threestep.jpg]]<br>		[[Image:threestep.jpg]]<br>
		+

	The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.		The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.
		+

	*"CGDP - DNA Amplification, Part 1." CGDP - DNA Amplification, Part 1. N.p., n.d. Web. 08 Nov. 2012. <http://www.flmnh.ufl.edu/cowries/amplify.html>.		*"CGDP - DNA Amplification, Part 1." CGDP - DNA Amplification, Part 1. N.p., n.d. Web. 08 Nov. 2012. <http://www.flmnh.ufl.edu/cowries/amplify.html>.

Swetha A. Swaminathan: /* Research and Development */

2012-11-15T17:31:01Z

Research and Development

←Older revision		Revision as of 17:31, 15 November 2012
Line 146:		Line 146:

	[[Image:pcrsteps.jpg]]<br>		[[Image:pcrsteps.jpg]]<br>
		+
	This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s.		This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s.

	[[Image:threestep.jpg]]<br>		[[Image:threestep.jpg]]<br>
		+
	The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.		The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.

		+	*"CGDP - DNA Amplification, Part 1." CGDP - DNA Amplification, Part 1. N.p., n.d. Web. 08 Nov. 2012. <http://www.flmnh.ufl.edu/cowries/amplify.html>.
		+	*"Principle of the PCR." Principle of the PCR. N.p., n.d. Web. 08 Nov. 2012. <http://users.ugent.be/~avierstr/principles/pcr.html>.
		+	*"Real-Time PCR:." Real Time PCR. N.p., n.d. Web. 08 Nov. 2012. <http://www.bio.davidson.edu/Courses/Molbio/Molstudents/spring2003/Pierce/realtimepcr.htm>.
	<br><br>		<br><br>

Swetha A. Swaminathan: /* Research and Development */

2012-11-15T17:27:55Z

Research and Development

←Older revision		Revision as of 17:27, 15 November 2012
Line 146:		Line 146:

	[[Image:pcrsteps.jpg]]<br>		[[Image:pcrsteps.jpg]]<br>
		+	This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s.

	[[Image:threestep.jpg]]<br>		[[Image:threestep.jpg]]<br>
		+	The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.

	<br><br>		<br><br>

Swetha A. Swaminathan: /* Research and Development */

2012-11-15T17:26:23Z

Research and Development

←Older revision		Revision as of 17:26, 15 November 2012
Line 145:		Line 145:
	[[Image:PCR Pic 1.jpg]]<br>		[[Image:PCR Pic 1.jpg]]<br>

-	[[Image:~~PCR Pic 2~~.jpg]]<br>	+	[[Image:pcrsteps.jpg]]<br>

-	~~Pictures from~~: ~~http://www.foodsafetywatch.com/public/1050~~.~~cfm~~	+	[[Image:threestep.jpg]]<br>

	<br><br>		<br><br>

Swetha A. Swaminathan: /* Protocols */

2012-11-15T17:13:55Z

Protocols

←Older revision		Revision as of 17:13, 15 November 2012
Line 48:		Line 48:

	To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained the solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps catalyze the matching of the dNTP's (or floating nucleotides) to make copies of the original DNA strand; the MgCl2 helps the Taq be more efficient. After the samples and controls were prepared, we placed the tubes in the open PCR machine and set the correct cycles and temperatures for the DNA to copied. This process took about an hour and a half to complete. Our samples were then collected and incubated until we received them again about two weeks later. <br>		To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained the solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps catalyze the matching of the dNTP's (or floating nucleotides) to make copies of the original DNA strand; the MgCl2 helps the Taq be more efficient. After the samples and controls were prepared, we placed the tubes in the open PCR machine and set the correct cycles and temperatures for the DNA to copied. This process took about an hour and a half to complete. Our samples were then collected and incubated until we received them again about two weeks later. <br>
		+
		+	'''Components of Master Mix'''<br>
		+
		+	*2X 25μl of GoTaq® Colorless Master Mix
		+	*1–5μl of DNA template
		+	*50μl Nuclease-Free Water
		+	*10μM of upstream primer
		+	*10μM of downstream primer

	'''Fluorimeter Procedures''' <br>		'''Fluorimeter Procedures''' <br>
Line 94:		Line 102:
	Patient 1 ID Number: 92136		Patient 1 ID Number: 92136

-	Male	+	*Male

-	54 Years	+	*54 Years

	Patient 2 ID Number: 62276		Patient 2 ID Number: 62276

-	Female	+	*Female

-	61 Years	+	*61 Years

	'''Fluorimeter Measurements'''<br>		'''Fluorimeter Measurements'''<br>

Swetha A. Swaminathan: /* Protocols */

2012-11-15T17:08:44Z

Protocols

←Older revision		Revision as of 17:08, 15 November 2012
Line 71:		Line 71:
	5. The image was found in the search box where it was ready to be analyzed.		5. The image was found in the search box where it was ready to be analyzed.

-	{\| ~~class~~="~~wikitable~~"	+
-	\|-	+	{\| {{table}}
-	! '''Reagent''' !! '''Volume'''	+	\|- style="background:#f0f0f0;"
		+	\| '''Reagent''' \|\| '''Volume'''
	\|-		\|-
	\| Template DNA (20ng) \|\| 0.2 μL		\| Template DNA (20ng) \|\| 0.2 μL
Line 87:		Line 88:
	\| '''Total Volume'''\|\| 100.0 μL		\| '''Total Volume'''\|\| 100.0 μL
	\|}		\|}
		+

	Here is the patient information:		Here is the patient information:

Swetha A. Swaminathan: /* Initial Machine Testing */

2012-11-15T17:02:14Z

Initial Machine Testing

←Older revision		Revision as of 17:02, 15 November 2012
Line 34:		Line 34:
	'''Test Run'''		'''Test Run'''

-	We first tested open PCR on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. Along with seeing how disconnecting some parts from the system would affect the PCR machine. By using open PCR we were able to make a polymerase chain reaction. In order for this to occur, open PCR had to send the DNA through different sets of temperatures to heat it up, causing the strands seperate and expose the bases. Then it cooled down the primers and combined it to the sequences. Then it was heated back up to attain an extension of the copy of the new DNA. Which was conducted in an hour and thirty minutes. The sample DNA was then used to test which patients had cancer. <br>	+	We first tested open PCR on machine 8 on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. Along with seeing how disconnecting some parts from the system would affect the PCR machine. By using open PCR we were able to make a polymerase chain reaction. In order for this to occur, open PCR had to send the DNA through different sets of temperatures to heat it up, causing the strands seperate and expose the bases. Then it cooled down the primers and combined it to the sequences. Then it was heated back up to attain an extension of the copy of the new DNA. Which was conducted in an hour and thirty minutes. The sample DNA was then used to test which patients had cancer. <br>

Swetha A. Swaminathan: /* Research and Development */

2012-11-15T17:01:52Z

Research and Development

←Older revision		Revision as of 17:01, 15 November 2012
Line 131:		Line 131:
	The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code.		The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code.

-	Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic a to how reliable the procedure is to detect the presence of cancer genes. Based on conditional probabilities from a tested sample of 180 people from Finland, it was found that the frequency of the appearance of this cancerous gene was 7.8 %. Approximately 1.1% of people have this C/T variation sequence, hence, T/T was found to be 98.9%.	+	Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic as to how reliable the procedure is to detect the presence of cancer genes. Based on conditional probabilities from a tested sample of 180 people from Finland, it was found that the frequency of the appearance of this cancerous gene was 7.8 %. Approximately 1.1% of people have this C/T variation sequence, hence, T/T was found to be 98.9%.

	[[Image:PCR Pic 1.jpg]]<br>		[[Image:PCR Pic 1.jpg]]<br>