Group 16
Name: Omar Moreno Salinas, and Rachel Juetten Open PCR, ImageJ Software Processor, Data Compiler, and Analyzers
| Name: Maggie McClure, and Swetha Swaminathan Protocol Persons: Sample Prep & Application
| Name: Marianna Singh DNA Measurement Operator
| Name: Muawiya Ali Al-Khalidi R&D Scientist
|
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design

The above image consists of the open PCR machine we used in our experiment. Specifically in our photo, the LCD screen reflects blue and is located on the top of the open PCR machine. The power supply is directly under the LCD screen, and the heat sink fan is lateral to the power supply. On the bottom of the open PCR machine rests the open PCR brains board, and it reflects a green color demonstrated above.
Experimenting With the Connections
When the heat sink is unplugged from the circuit board, the LCD screen is turned off. When we unplugged the white wire that connected the circuit board to the heating block the temperature reading on the LCD screen dropped drastically.
Test Run
We first tested open PCR on machine 8 on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. Along with seeing how disconnecting some parts from the system would affect the PCR machine. By using open PCR we were able to make a polymerase chain reaction. In order for this to occur, open PCR had to send the DNA through different sets of temperatures to heat it up, causing the strands seperate and expose the bases. Then it cooled down the primers and combined it to the sequences. Then it was heated back up to attain an extension of the copy of the new DNA. Which was conducted in an hour and thirty minutes. The sample DNA was then used to test which patients had cancer.
Protocols
Polymerase Chain Reaction
The open PCR machine makes many copies of a DNA segment. It allows for a large enough sample to be made in order to analyze the DNA. In this lab we made copies of a specific segment of DNA that would allow us to determine whether or not our patients had the gene for cancer.
Sample Procedures
To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained the solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps catalyze the matching of the dNTP's (or floating nucleotides) to make copies of the original DNA strand; the MgCl2 helps the Taq be more efficient. After the samples and controls were prepared, we placed the tubes in the open PCR machine and set the correct cycles and temperatures for the DNA to copied. This process took about an hour and a half to complete. Our samples were then collected and incubated until we received them again about two weeks later.
Components of Master Mix
- 2X 25μl of GoTaq® Colorless Master Mix
- 1–5μl of DNA template
- 50μl Nuclease-Free Water
- 10μM of upstream primer
- 10μM of downstream primer
Fluorimeter Procedures
Next we began analyzing the samples by creating another solution that would allow positive samples for cancer to glow.
1. We labeled ten transfer pipettes: one with a blue dash for our SYBR green solution, 1 with a red dot for our DNA Calf thymus, a positive control, negative control, 3 for our first patient and the last three for our second patient (The labeling was important so that we would avoid cross-contamination which could heavily skew our results)
2. Put two drops of SYBR green on the sample slate
3. Then add two drops of the positive control to the SYBR green.
4. Next align the light so that it hits the sample
5. Place the sample under the the black box
6. Take a picture using a smart phone
7. Recorded whether or not it was able to glow
8. Remove the liquid from the slide and discard it along with the pipette
9.We followed the same procedure (steps 2-8) using the corresponding pipettes for each of the remaining patient samples, our water sample and our sample of DNA Calf Thymus
We recorded the samples' ability to glow based on the pictures to determine which samples were positive for the cancer gene that we amplified (or copied) with the open PCR machine.
ImageJ Procedures
1. A picture of the fluorimeter assembly was taken with a smartphone
2. Then the picture was transferred to a laptop equipped with the ImageJ software via icloud or email
3. The file was converted to a tiff
4. Then imported in the ImageJ options was selected to obtain the TIFF virtual stack
5. The image was found in the search box where it was ready to be analyzed.
| Reagent | Volume
|
| Template DNA (20ng) | 0.2 μL
|
| 10 μM forward primer | 1.0 μL
|
| 10 μM reverse primer | 1.0 μL
|
| GoTaq master mix | 50.0 μL
|
| dH2O | 47.8 μL
|
| Total Volume | 100.0 μL
|
Here is the patient information:
Patient 1 ID Number: 92136
Patient 2 ID Number: 62276
Fluorimeter Measurements
 The Fluorimeter
 Fluorimeter with SYBR Green and Water
 Fluorimeter with SYBR Green and DNA Calf Thymus
How does the fluorimetry technique work?
The fluorimeter is an instrument that detects fluorescence; the quantity is related to the amount of fluorescent material and is indirectly proportional to the molecule being detected. The slide that enters the fluorimeter is coated with a rough layer of Teflon which allows drops of liquid to form beads on the surface due to the surface tension. Because of this, the light from the Blue LED is focused in the drop which increases the intensity, and the SYBR Green in the liquid causes the presence of DNA to be indicated through a green phosphorescence. In this procedure, two drops of SYBR Green were placed on the slide, and then two drops of the solutions from the samples being tested were placed on top of the SYBR Green. The fluorimeter will give a visual color signal when dsDNA is present, and this can be quantified by taking an image. This is done by placing the smartphone camera (in this case, a Samsung HTC 1) into a diffraction grating and mounting it, and then setting exposure and saturation levels. By the use of a self-timer, the least amount of outside light was allowed in.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
A Polymerase chain reaction is a machine that amplifies a single or a few strands of DNA to generate millions of copies of that DNA sequence. Using this technology scientists can determine whether a patient has a positive or negative result towards cancer. A method of getting this data is called the PCR detection method, that relies on thermal cycling, switching back and forth to melt DNA and then connect primers. The PCR is used to detect whether a patient has positive result for cancer, because a sample of DNA can be taken and whether that connects to the primers and creates a chain reaction, scientists can then determine whether this DNA is positive or negative towards cancer. An example of proving this method can be seen using the r17879961 SNP, a cancer-associated sequence, using the PCR detection method we can prove that r17879961 SNP is actually associated with cancer. Because it carries with the Polymerase chain reaction, and to further prove the patient has a positive result for sample, we used fluorescent dye and if the DNA glowed in the solution, then the results were positive for cancer.
Thermal cycling takes place in three distinct steps based on temperature.
At 95° Celsius, the DNA unzips and melts into two one-stranded strips. Several primers are then added to the solution
At 57°Celsius, the primers are joined to the complementing template sequence to then form one forward primer and one reverse primer.
At 72° Celsius, the Taq Polymerase enzyme finishes the replication process through the assistance of the dNTP's and MgCl2
The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code.
Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic as to how reliable the procedure is to detect the presence of cancer genes. Based on conditional probabilities from a tested sample of 180 people from Finland, it was found that the frequency of the appearance of this cancerous gene was 7.8 %. Approximately 1.1% of people have this C/T variation sequence, hence, T/T was found to be 98.9%.


This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s.

The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s.
Sources:
Results
| Sample | Integrated Density | DNA μg/mL | Conclusion
|
| PCR: Negative Control | 9880697
| 1.57 | negative
|
| PCR: Positive Control | 4981557
| .7946 | positive
|
| PCR: Patient 1 ID 25654, rep 1 | 14455570
| 2.305 | positive
|
| PCR: Patient 1 ID 25654, rep 2 | 8591662
| 1.37 | positive
|
| PCR: Patient 1 ID 25654, rep 3 | 13212871
| 2.107 | positive
|
| PCR: Patient 2 ID 34311, rep 1 | 12472923
| 1.989 | positive
|
| PCR: Patient 2 ID 34311, rep 2 | 22091168
| 3.523 | positive
|
| PCR: Patient 2 ID 34311, rep 3 | 11477553
| 1.830 | positive
|
KEY
- Sample = Subject of DNA that was tested.
- Integrated Density = The sum of the pixels within the Image J photo. Background subtraction was performed using the integrated density of the DNA sample and the integrated density of the space surrounding the sample.
- DNA μg/mL = Concentration of the sample, it was calculated by setting up a simple proportion. The sample's integrated density was placed over a variable, and then set equal to the integrated density of the DNA calfthymus over two. The result of this proper proportion leads to the concentration of the specific sample.
- Conclusion = A positive conclusion demonstrates a sample that has reflected successfully demonstrating a "positive result." On the other hand, a negative conclusion, or "no signal" represents a sample that has not demonstrated a successful result. For example, our purposeful positive control resulted positive, and our negative control resulted in a negative result.
- Note: The results came up with large numbers for nearly every sample, including the negative control. However, when looking at the pictures and the raw data, there seems to be less variability in the data. Hence, it is concluded that cross-contamination of the data or extrapolation of the samples and overamplification of DNA led to these results being skewed.
|
|